IthaID: 945



Names and Sequences

Functionality: Globin gene causative mutation Pathogenicity: Pathogenic / Likely Pathogenic
Common Name: CD 42 (-TTT) HGVS Name: HBB:c.127_129delTTT
Hb Name: Hb Bruxelles Protein Info: N/A

Context nucleotide sequence:
GGTCTACCCTTGGACCCAGAGGTTC [-/TTT] GAGTCCTTTGGGGATCTGTCCA (Strand: -)

Also known as:

Comments: Reported in a 4-year-old girl with severe chronic hemolytic anaemia and cyanosis. Abnormal haemoglobin variant by IEF and RP-HPLC. Peptide consisted of two phenylalanine residues instead of three in normal β chains (codons 41, 42, and 45). Sequence analysis showed that the β42 residue is missing. Unstable variant by isopropanol stability test. Low oxygen affinity (P50= 41 mmHg).

We follow the HGVS sequence variant nomenclature and IUPAC standards.

Phenotype

Hemoglobinopathy Group: Structural Haemoglobinopathy
Hemoglobinopathy Subgroup: β-chain variant
Allele Phenotype:N/A
Stability: Unstable
Oxygen Affinity: Decreased Oxygen Affinity
Associated Phenotypes: N/A

Location

Chromosome: 11
Locus: NG_000007.3
Locus Location: 70851
Size: 3 bp
Located at: β
Specific Location: Exon 2

Other details

Type of Mutation: Point-Mutation(Deletion)
Effect on Gene/Protein Function: Insertion/Deletion of codons (Protein Structure)
Ethnic Origin: Belgian
Molecular mechanism: Altered heme pocket
Inheritance: Recessive
DNA Sequence Determined: Yes

In silico pathogenicity prediction

Sequence Viewer

Note: The NCBI Sequence Viewer is not installed on the ITHANET servers but it is embedded in this page from the NCBI. Therefore, IthaGenes has no responsibility over any temporary unavailability of the service. In such a case, please Refresh the page or retry at a later stage. Otherwise, use this external link.

Publications / Origin

  1. Blouquit Y, Bardakdjian J, Lena-Russo D, Arous N, Perrimond H, Orsini A, Rosa J, Galacteros F, Hb Bruxelles: alpha 2A beta (2)41 or 42(C7 or CD1)Phe deleted., Hemoglobin, 13(5), 465-74, 1989 PubMed
  2. Griffon N, Badens C, Lena-Russo D, Kister J, Bardakdjian J, Wajcman H, Marden MC, Poyart C, Hb Bruxelles, deletion of Phebeta42, shows a low oxygen affinity and low cooperativity of ligand binding., J. Biol. Chem., 271(42), 25916-20, 1996 PubMed
Created on 2010-06-16 16:13:16, Last reviewed on 2020-07-01 11:54:50 (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.