IthaID: 878
Names and Sequences
| Functionality: | Globin gene causative mutation | Pathogenicity: | Pathogenic / Likely Pathogenic |
|---|---|---|---|
| Common Name: | CD 23/24 (GTTGGT>GGT) | HGVS Name: | HBB:c.71_73del |
| Hb Name: | Hb Freiburg | Protein Info: | β 23(B5) Val->0 |
Context nucleotide sequence:
GGGGCAAGGTGAACGTGGATGAAG [-/TTG] GTGGTGAGGCCCTGGGCAGGTTG (Strand: -)
Also known as:
Comments: Found in a German women presenting with hemolysis and mild cyanosis, as well as in two of her three children. Not detected in her parents or three siblings. Oxygen affinity and stability tests performed.
We follow the HGVS sequence variant nomenclature and IUPAC standards.
Phenotype
| Hemoglobinopathy Group: | Structural Haemoglobinopathy |
|---|---|
| Hemoglobinopathy Subgroup: | β-chain variant |
| Allele Phenotype: | N/A |
| Stability: | Unstable |
| Oxygen Affinity: | Increased Oxygen Affinity |
| Associated Phenotypes: | N/A |
Location
| Chromosome: | 11 |
|---|---|
| Locus: | NG_000007.3 |
| Locus Location: | 70665 |
| Size: | 3 bp |
| Located at: | β |
| Specific Location: | Exon 1 |
Other details
| Type of Mutation: | Point-Mutation(Deletion) |
|---|---|
| Effect on Gene/Protein Function: | Frameshift (Translation) |
| Ethnic Origin: | German |
| Molecular mechanism: | N/A |
| Inheritance: | Recessive |
| DNA Sequence Determined: | No |
In silico pathogenicity prediction
Note:
The impact thresholds provided in this section are based on the analyses performed in Tamana et.al. For any given tool, the impact thresholds defined for the set of variants with the same effect on function as the variant examined, are preferred over those defined for the full dataset.
Sequence Viewer
Note: The NCBI Sequence Viewer is not installed on the ITHANET servers but it is embedded in this page from the NCBI.
Therefore, IthaGenes has no responsibility over any temporary unavailability of the service.
In such a case, please Refresh the page or retry at a later stage.
Otherwise, use this external link.
Publications / Origin
- Jones RT, Brimhall B, Huisman TH, Kleihauer E, Betke K, Hemoglobin Freiburg: abnormal hemoglobin due to deletion of a single amino acid residue., Science (New York, N.Y.), 154(752), 1024-7, 1966 PubMed
Created on 2010-06-16 16:13:16,
Last reviewed on 2019-11-11 15:45:32 (Show full history)
| A/A | Date | Curator(s) | Comments |
|---|---|---|---|
| 1 | 2010-06-16 16:13:16 | The IthaGenes Curation Team | Created |
| 2 | 2013-10-15 17:00:14 | The IthaGenes Curation Team | Reviewed. |
| 3 | 2019-11-11 15:45:32 | The IthaGenes Curation Team | Reviewed. Mutation names, DNA info, Location and Size corrected. Comment added. |
Disclaimer: The information on this website is provided as an information resource only
and must not to be used as a substitute for professional diagnosis and treatment.
The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment,
diagnosis or any other information, services or products that an individual obtains through this website.
IthaGenes was last updated on 2024-11-20 13:24:07