IthaID: 828

Names and Sequences

Functionality:	Globin gene causative mutation	Pathogenicity:	Pathogenic / Likely Pathogenic
Common Name:	CD 7 (-GAG) [-Glu]	HGVS Name:	HBB:c.22_24delGAG
Hb Name:	Hb Leiden	Protein Info:	β7 (A4) Glu->0

Context nucleotide sequence:
CATGGTGCATCTGACTCCTGAG [GAG/-] AAGTCTGCCGTTACTGCCCTGT (Strand: -)

Also known as: Hb Xinyi

Comments: In a recent unpublish report, it was found in a 6-month-old male in compound heterozygosity with Hb Dahua [IthaID: 3747] and Hb Q-Thailand [IthaID: 607] with no clinical presentation. He presented with Hb 11.9 g/dL, RBC 4.74×10^12/L, MCV 80.0 fL, and MCH 25.0 pg. Capillary electrophoresis shown HbA 65.9 %, Hb Xinyi 7.6 %, Hb F + Hb Q-Thailand 22.2 %, HbA2 1.3 %, Hb Q-Thailand-HbA2 1.1% and Hb Xinyi-Q-Thailand 1.9%.

External Links

HbVar	dbSNP
OMIM	LOVD

Phenotype

Hemoglobinopathy Group:	Structural Haemoglobinopathy
Hemoglobinopathy Subgroup:	β-chain variant
Allele Phenotype:	N/A
Stability:	Unstable
Oxygen Affinity:	Decreased Oxygen Affinity
Associated Phenotypes:	N/A

IthaPhen

Heterozygous records (preview in IthaPhen)

Location

Chromosome:	11
Locus:	NG_000007.3
Locus Location:	70616
Size:	3 bp
Located at:	β
Specific Location:	Exon 1

Other details

Type of Mutation:	Point-Mutation(Deletion)
Effect on Gene/Protein Function:	Insertion/Deletion of codons (Protein Structure)
Ethnic Origin:	American, Chinese, Mexican, Netherlands, South African, Yugoslavian, Dutch
Molecular mechanism:	N/A
Inheritance:	Recessive
DNA Sequence Determined:	Yes

Sequence Viewer

Note: The NCBI Sequence Viewer is not installed on the ITHANET servers but it is embedded in this page from the NCBI. Therefore, IthaGenes has no responsibility over any temporary unavailability of the service. In such a case, please Refresh the page or retry at a later stage. Otherwise, use this external link.

Publications / Origin

De Jong WW, Went LN, Bernini LF, Haemoglobin Leiden: deletion of beta-6 or 7 glutamic acid., Nature, 220(5169), 788-90, 1968 PubMed
Jongbloed W, van Twillert G, Schoorl M, Schindhelm RK, Unstable haemoglobin variant Hb Leiden is detected on Sysmex XN-Series analysers., Clin Chem Lab Med, 56(9), e249-e250, 2018 PubMed

Created on 2010-06-16 16:13:16, Last reviewed on 2021-08-26 12:18:54 (Show full history)

A/A	Date	Curator(s)	Comments
1	2010-06-16 16:13:16	The IthaGenes Curation Team	Created
2	2013-10-15 17:00:14	The IthaGenes Curation Team	Reviewed.
3	2021-08-26 12:18:54	The IthaGenes Curation Team	Reviewed. Common name corrected. Origin, protein function and reference added.

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.