IthaID: 828

Names and Sequences

Functionality:	Globin gene causative mutation
Common Name:	CD 6/7(-GAG)	HGVS Name:	HBB:c.22_24delGAG
Hb Name:	Hb Leiden	Protein Info:	β 6(A3) Glu->0 OR β 7(A4) Glu->0

Context nucleotide sequence:
CACCATGGTGCATCTGACTCCTGAG [-/GAG] AAGTCTGCCGTTACTGCCCTGTGGG (Strand: -)

Also known as:

External Links

HbVar	dbSNP
OMIM	LOVD

Location

Chromosome:	11
Locus:	NG_000007.3
Locus Location:	70616
Size:	1 bp
Located at:	β
Specific Location:	Exon 1

Phenotype

Hemoglobinopathy Group:	Structural Haemoglobinopathy
Hemoglobinopathy Subgroup:	β-chain variant
Allele Phenotype:	N/A
Stability:	Unstable
Oxygen Affinity:	Decreased Oxygen Affinity
Associated Phenotypes:	N/A

Other details

Type of Mutation:	Point-Mutation(Deletion)
Effect on Gene/Protein Function:	N/A
Ethnic Origin:	American \| Chinese \| Mexican \| Netherlands \| South African \| Yugoslavian
Inheritance:	Recessive
DNA Sequence Determined:	No

Sequence Viewer

Note: The NCBI Sequence Viewer is not installed on the ITHANET servers but it is embedded in this page from the NCBI. Therefore, IthaGenes has no responsibility over any temporary unavailability of the service. In such a case, please Refresh the page or retry at a later stage. Otherwise, use this external link.

Publications / Origin

De Jong WW, Went LN, Bernini LF, Haemoglobin Leiden: deletion of beta-6 or 7 glutamic acid., Nature, 220(5169), 788-90, 1968 PubMed

Created on 2010-06-16 16:13:16, Last reviewed on 2013-10-15 17:00:14 (Show full history)

A/A	Date	Curator(s)	Comments
1	2010-06-16 16:13:16	The IthaGenes Curation Team	Created
2	2013-10-15 17:00:14	The IthaGenes Curation Team	Reviewed.

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.