IthaID: 8



Names and Sequences

Functionality: Globin gene causative mutation Pathogenicity: Pathogenic / Likely Pathogenic
Common Name: -88 (C>T) HGVS Name: HBB:c.-138C>T
Hb Name: N/A Protein Info: N/A
Also known as:

We follow the HGVS sequence variant nomenclature and IUPAC standards.

Context nucleotide sequence:
TTAGACCTCACCCTGTGGAGCCACA [A/C/G/T] CCTAGGGTTGGCCAATCTACTCCCA (Strand: -)

External Links

Phenotype

Hemoglobinopathy Group: Thalassaemia
Hemoglobinopathy Subgroup: β-thalassaemia
Allele Phenotype:β++
Associated Phenotypes: Haemolytic anaemia [HP:0001878]
Ineffective erythropoiesis [HP:0010972]

Location

Chromosome: 11
Locus: NG_000007.3
Locus Location: 70457
Size: 1 bp
Located at: β
Specific Location: Promoter

Other details

Type of Mutation: Point-Mutation(Substitution)
Effect on Gene/Protein Function: Promoter (Transcription)
Ethnic Origin: African-American, Asian Indians, Pakistani
Molecular mechanism: N/A
Inheritance: Recessive
DNA Sequence Determined: Yes

In silico pathogenicity prediction

Sequence Viewer

Note: The NCBI Sequence Viewer is not installed on the ITHANET servers but it is embedded in this page from the NCBI. Therefore, IthaGenes has no responsibility over any temporary unavailability of the service. In such a case, please Refresh the page or retry at a later stage. Otherwise, use this external link.

Frequencies

Publications / Origin

  1. Orkin SH, Antonarakis SE, Kazazian HH, Base substitution at position -88 in a beta-thalassemic globin gene. Further evidence for the role of distal promoter element ACACCC., The Journal of biological chemistry, 259(14), 8679-81, 1984 PubMed
  2. Thein SL, Hesketh C, Wallace RB, Weatherall DJ, The molecular basis of thalassaemia major and thalassaemia intermedia in Asian Indians: application to prenatal diagnosis., British journal of haematology, 70(2), 225-31, 1988 PubMed
  3. Yasmeen H, Toma S, Killeen N, Hasnain S, Foroni L, The molecular characterization of Beta globin gene in thalassemia patients reveals rare and a novel mutations in Pakistani population., Eur J Med Genet , 59(8), 355-62, 2016 PubMed
Created on 2010-06-16 16:13:14, Last reviewed on 2016-09-02 14:07:42 (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.