IthaID: 78



Names and Sequences

Functionality: Globin gene causative mutation Pathogenicity: Pathogenic / Likely Pathogenic
Common Name: CD 17 (+A) HGVS Name: HBB:c.53dup
Hb Name: N/A Protein Info: N/A

Context nucleotide sequence:
GTTACTGCCCTGTGGGGCAA [-/Α] GGTGAACGTGGATGAAGTTG (Strand: -)

Also known as:

Comments: The insertion found in an Italian girl associated with the deletion of the 13.4-kb δβ-globin gene region. The insertion of a nt A in codon 17 creates a shift in the reading frame with a premature stop codon at codon 22 (TGA).

External Links

Location

Chromosome: 11
Locus: NG_000007.3
Locus Location: 70647
Size: 1 bp
Located at: β
Specific Location: Exon 1

Phenotype

Hemoglobinopathy Group: Thalassaemia
Hemoglobinopathy Subgroup: β-thalassaemia
Allele Phenotype:β0
Associated Phenotypes: Haemolytic anaemia [HP:0001878]
Ineffective erythropoiesis [HP:0010972]

Other details

Type of Mutation: Point-Mutation(Insertion)
Effect on Gene/Protein Function: Frameshift (Translation)
Ethnic Origin: Italian
Molecular mechanism: N/A
Inheritance: Recessive
DNA Sequence Determined: No

Sequence Viewer

Note: The NCBI Sequence Viewer is not installed on the ITHANET servers but it is embedded in this page from the NCBI. Therefore, IthaGenes has no responsibility over any temporary unavailability of the service. In such a case, please Refresh the page or retry at a later stage. Otherwise, use this external link.

Publications / Origin

  1. Feriotto G, Salvatori F, Finotti A, Breveglieri G, Venturi M, Zuccato C, Bianchi N, Borgatti M, Lampronti I, Mancini I, Massei F, Favre C, Gambari R, A novel frameshift mutation (+A) at codon 18 of the beta-globin gene associated with high persistence of fetal hemoglobin phenotype and deltabeta-thalassemia., Acta haematologica, 119(1), 28-37, 2008 PubMed
Created on 2010-06-16 16:13:14, Last reviewed on 2020-05-05 10:46:07 (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.