IthaID: 775
Names and Sequences
| Functionality: | Globin gene causative mutation | Pathogenicity: | Variant of Uncertain Significance |
|---|---|---|---|
| Common Name: | CD 139 (-A) | HGVS Name: | HBA2:c.420delA |
| Hb Name: | Hb Wayne | Protein Info: | α2 139 (-A); modified C-terminal sequence: (139)Asn-Thr-Val-Lys-Leu-Glu-Pro-(146)Arg-COOH |
Context nucleotide sequence:
CTGTGAGCACCGTGCTGACCTCCAA [A/-] TACCGTTAAGCTGGAGCCTCGGTGG (Strand: +)
Also known as:
We follow the HGVS sequence variant nomenclature and IUPAC standards.
Phenotype
| Hemoglobinopathy Group: | Structural Haemoglobinopathy |
|---|---|
| Hemoglobinopathy Subgroup: | α-chain variant |
| Allele Phenotype: | N/A |
| Stability: | N/A |
| Oxygen Affinity: | Increased Oxygen Affinity |
| Associated Phenotypes: | N/A |
Location
| Chromosome: | 16 |
|---|---|
| Locus: | NG_000006.1 |
| Locus Location: | 34454 |
| Size: | 1 bp |
| Located at: | α2 |
| Specific Location: | Exon 3 |
Other details
| Type of Mutation: | Point-Mutation(Substitution) |
|---|---|
| Effect on Gene/Protein Function: | Frameshift (Translation) |
| Ethnic Origin: | Caucasian |
| Molecular mechanism: | N/A |
| Inheritance: | Recessive |
| DNA Sequence Determined: | Yes |
In silico pathogenicity prediction
Note:
The impact thresholds provided in this section are based on the analyses performed in Tamana et.al. For any given tool, the impact thresholds defined for the set of variants with the same effect on function as the variant examined, are preferred over those defined for the full dataset.
Sequence Viewer
Note: The NCBI Sequence Viewer is not installed on the ITHANET servers but it is embedded in this page from the NCBI.
Therefore, IthaGenes has no responsibility over any temporary unavailability of the service.
In such a case, please Refresh the page or retry at a later stage.
Otherwise, use this external link.
Publications / Origin
- Nachmansohn D, Transduction of chemical into electrical energy., Proc. Natl. Acad. Sci. U.S.A. , 73(1), 82-5, 1976 PubMed
- Huisman TH, Headlee MG, Wilson JB, Lam H, Johnson SE, Webber BB, Hb Wayne, the frameshift variant with extended alpha chains observed in a Caucasian family from Alabama., Hemoglobin , 8(1), 1-15, 1984 PubMed
- Moo-Penn WF, Jue DL, Johnson MH, McDonald MJ, Turci SM, Shih TB, Jones RT, Therrell BL, Arnone A, Structural and functional studies of hemoglobin Wayne: an elongated alpha-chain variant., J Mol Biol, 180(4), 1119-40, 1984 PubMed
- Rodríguez-Capote K, Estey MP, Barakauskas VE, Burton T, Holmes D, Krause R, Higgins TN, Identification of Hb Wayne and its effects on HbA1c measurement by 5 methods., Clin Biochem, 48(0), 1144-50, 2015 PubMed
- Henderson SJ, Timbs AT, McCarthy J, Gallienne AE, Proven M, Rugless MJ, Lopez H, Eglinton J, Dziedzic D, Beardsall M, Khalil MS, Old JM, Ten Years of Routine α- and β-Globin Gene Sequencing in UK Hemoglobinopathy Referrals Reveals 60 Novel Mutations., Hemoglobin , 40(2), 75-84, 2016 PubMed
Created on 2010-06-16 16:13:16,
Last reviewed on 2023-12-19 15:25:13 (Show full history)
| A/A | Date | Curator(s) | Comments |
|---|---|---|---|
| 1 | 2010-06-16 16:13:16 | The IthaGenes Curation Team | Created |
| 2 | 2013-10-15 17:00:14 | The IthaGenes Curation Team | Reviewed. |
| 3 | 2014-04-15 12:49:56 | The IthaGenes Curation Team | Reviewed. Added common name, allele phenotype, reference and ClinVar link. |
| 4 | 2021-04-07 12:48:47 | The IthaGenes Curation Team | Reviewed. HGVS, protein name and Locus location corrected. References added. |
| 5 | 2023-12-19 15:25:13 | The IthaGenes Curation Team | Reviewed. Reference added |
Disclaimer: The information on this website is provided as an information resource only
and must not to be used as a substitute for professional diagnosis and treatment.
The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment,
diagnosis or any other information, services or products that an individual obtains through this website.
IthaGenes was last updated on 2024-11-20 13:24:07