IthaID: 74
Names and Sequences
Functionality: | Globin gene causative mutation | Pathogenicity: | Pathogenic / Likely Pathogenic |
---|---|---|---|
Common Name: | CD 15/16 (-G) | HGVS Name: | HBB:c.50delG |
Hb Name: | N/A | Protein Info: | N/A |
Context nucleotide sequence:
GAGAAGTCTGCCGTTACTGCCCTGTGGG [-/G] CAAGGTGAACGTGGATGAAGTTGGTGGTG (Strand: -)
Also known as:
Comments: Found in individuals with heterozygous β-thalassaemia of German origin. Loss of a nt G in a run of four guanines in codons 15 and 16, generating a premature TGA stop between codons 19 and 20.
Phenotype
Hemoglobinopathy Group: | Thalassaemia |
---|---|
Hemoglobinopathy Subgroup: | β-thalassaemia |
Allele Phenotype: | β0 |
Associated Phenotypes: |
Haemolytic anaemia [HP:0001878] Ineffective erythropoiesis [HP:0010972] |
Location
Chromosome: | 11 |
---|---|
Locus: | NG_000007.3 |
Locus Location: | 70644 |
Size: | 1 bp |
Located at: | β |
Specific Location: | Exon 1 |
Other details
Type of Mutation: | Point-Mutation(Deletion) |
---|---|
Effect on Gene/Protein Function: | Frameshift (Translation) |
Ethnic Origin: | German |
Molecular mechanism: | N/A |
Inheritance: | Recessive |
DNA Sequence Determined: | No |
Sequence Viewer
Note: The NCBI Sequence Viewer is not installed on the ITHANET servers but it is embedded in this page from the NCBI.
Therefore, IthaGenes has no responsibility over any temporary unavailability of the service.
In such a case, please Refresh the page or retry at a later stage.
Otherwise, use this external link.
Frequencies
Publications / Origin
- Vetter B, Schwarz C, Kohne E, Kulozik AE, Beta-thalassaemia in the immigrant and non-immigrant German populations., British journal of haematology, 97(2), 266-72, 1997 PubMed
Created on 2010-06-16 16:13:14,
Last reviewed on 2019-11-11 10:36:51 (Show full history)
A/A | Date | Curator(s) | Comments |
---|---|---|---|
1 | 2010-06-16 16:13:14 | The IthaGenes Curation Team | Created |
2 | 2013-10-15 17:28:32 | The IthaGenes Curation Team | Reviewed. |
3 | 2019-11-11 10:36:51 | The IthaGenes Curation Team | Reviewed. HGVS name and Location corrected. Allele info and Comment added. |
Disclaimer: The information on this website is provided as an information resource only
and must not to be used as a substitute for professional diagnosis and treatment.
The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment,
diagnosis or any other information, services or products that an individual obtains through this website.
IthaGenes was last updated on 2021-02-26 08:21:52