IthaID: 684



Names and Sequences

Functionality: Globin gene causative mutation Pathogenicity: Pathogenic / Likely Pathogenic
Common Name: CD 95 CCG>CGG [Pro>Arg] HGVS Name: HBA1:c.287C>G
Hb Name: Hb St. Luke's Protein Info: α1 95(G2) Pro>Arg
Also known as:

We follow the HGVS sequence variant nomenclature and IUPAC standards.

Context nucleotide sequence:
CACGCGCACAAGCTTCGGGTGGACC [A/C/G/T] GGTCAACTTCAAGGTGAGCGGCGGG (Strand: +)

Phenotype

Hemoglobinopathy Group: Structural Haemoglobinopathy
Hemoglobinopathy Subgroup: α-chain variant
Allele Phenotype:N/A
Stability: Unstable
Oxygen Affinity: Increased Oxygen Affinity
Associated Phenotypes: N/A

Location

Chromosome: 16
Locus: NG_000006.1
Locus Location: 37983
Size: 1 bp
Located at: α1
Specific Location: Exon 2

Other details

Type of Mutation: Point-Mutation(Substitution)
Effect on Gene/Protein Function: Missense codons (Protein Structure)
Ethnic Origin: Japanese, Maltese
Molecular mechanism: N/A
Inheritance: Recessive
DNA Sequence Determined: Yes

HPLC

Disclaimer: The HPLC images are provided as an information resource only. Bio-Rad Laboratories, Inc and the ITHANET Portal disclaim responsibility and have no liability if this information is used for diagnostic or treatment purposes. D-10™ and VARIANT™ are registered trademarks of Bio-Rad Laboratories, Inc. and used with permission. Redistribution and use of the above material is allowed only with permission by Bio-Rad Laboratories, Inc. To access HPLC images and reports for different variants, use the IthaChrom tool.
ID Hb Variant Gene Instrument Method Area (%) Ret Time (min) Comments
327Hb St. Luke'sα1D-10Dual Kit Program8.54.21Heterozygous. Elutes with HbS. [PDF]
328Hb St. Luke'sα1VARIANT IIβ-thal Short Program9.44.46Heterozygous. Elutes with HbS. [PDF]
329Hb St. Luke'sα1VARIANT IIβ-thal Short Program8.84.58Heterozygous. Elutes with HbS. [PDF]
330Hb St. Luke'sα1VARIANT IIDual Kit Program8.83.68Heterozygous.[PDF]

In silico pathogenicity prediction

Sequence Viewer

Note: The NCBI Sequence Viewer is not installed on the ITHANET servers but it is embedded in this page from the NCBI. Therefore, IthaGenes has no responsibility over any temporary unavailability of the service. In such a case, please Refresh the page or retry at a later stage. Otherwise, use this external link.

Publications / Origin

  1. Bannister WH, Grech JL, Plese CF, Smith LL, Barton BP, Wilson JB, Reynolds CA, Huisman TH, Hemoglobin St Luke's, or alpha 2 , 95 Arg (G2) beta 2 ., Eur. J. Biochem. , 29(2), 301-7, 1972 PubMed
  2. Lorkin PA, Casey R, Clark KG, Lehmann H, The oxygen affinity of haemoglobin St. Luke's., FEBS Lett. , 39(1), 111-4, 1974 PubMed
  3. Harano T, Harano K, Shibata S, Ueda S, Tsuchida J, Marumoto K, Yakeishi Y, Murakami T, Hb St. Luke's [alpha 95 (G2) Pro replaced by Arg] in Japan., Hemoglobin , 7(5), 471-2, 1983 PubMed
  4. Molchanova TP, Pobedimskaya DD, Huisman TH, The differences in quantities of alpha 2- and alpha 1-globin gene variants in heterozygotes., Br. J. Haematol. , 88(2), 300-6, 1994 PubMed
Created on 2010-06-16 16:13:16, Last reviewed on 2014-04-14 14:54:55 (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.