IthaID: 6



Names and Sequences

Functionality: Globin gene causative mutation Pathogenicity: Pathogenic / Likely Pathogenic
Common Name: -92 (C>T) HGVS Name: HBB:c.-142C>T
Hb Name: N/A Protein Info: N/A
Also known as:

We follow the HGVS sequence variant nomenclature and IUPAC standards.

Context nucleotide sequence:
TCACTTAGACCTCACCCTGTGGAGC [C/T] ACACCCTAGGGTTGGCCAATCTACT (Strand: -)

Comments: An updated case was reported in a 33-year-old female in association with −α3.7 with a slightly increased Hb A2 level.

Phenotype

Hemoglobinopathy Group: Thalassaemia
Hemoglobinopathy Subgroup: β-thalassaemia
Allele Phenotype:β++ (silent)
Associated Phenotypes: Haemolytic anaemia [HP:0001878]
Ineffective erythropoiesis [HP:0010972]

Location

Chromosome: 11
Locus: NG_000007.3
Locus Location: 70453
Size: 1 bp
Located at: β
Specific Location: Promoter

Other details

Type of Mutation: Point-Mutation(Substitution)
Effect on Gene/Protein Function: Promoter (Transcription)
Ethnic Origin: Mediterranean
Molecular mechanism: N/A
Inheritance: Recessive
DNA Sequence Determined: Yes

In silico pathogenicity prediction

Sequence Viewer

Note: The NCBI Sequence Viewer is not installed on the ITHANET servers but it is embedded in this page from the NCBI. Therefore, IthaGenes has no responsibility over any temporary unavailability of the service. In such a case, please Refresh the page or retry at a later stage. Otherwise, use this external link.

Frequencies

Publications / Origin

  1. Divoky V, Baysal E, Schiliro G, Dibenedetto SP, Huisman TH, A mild type of Hb S-beta(+)-thalassemia [-92(C-->T)] in a Sicilian family., American journal of hematology, 42(2), 225-6, 1993 PubMed
  2. Kimberland ML, Boehm CD, Kazazian HH, Two novel beta-thalassemia alleles: poly A signal (AATAAA-->AAAA) and -92 C-->T., Human mutation, 5(3), 275-6, 1995 PubMed
  3. Rosatelli MC, Faà V, Meloni A, Fiorenza F, Galanello R, Gasperini D, Amendola G, Cao A, A promoter mutation, C-->T at position -92, leading to silent beta-thalassaemia., British journal of haematology, 90(2), 483-5, 1995 PubMed

Microattributions

A/AContributor(s)DateComments
1Petrou, Miranda2022-09-23Report of an update.
Created on 2010-06-16 16:13:14, Last reviewed on 2022-09-23 11:11:42 (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.