IthaID: 57



Names and Sequences

Functionality: Globin gene causative mutation
Common Name: CD 6 -A HGVS Name: HBB:c.20delA
Hb Name: N/A Protein Info: β 6 (-A); modified C-terminal sequence: (6)Gly-Arg-Ser-Leu-Pro-Leu-Leu-Pro-Cys-Gly- Ala-(17)Arg-COOH

Context nucleotide sequence:
GACACCATGGTGCATCTGACTCCTG [-/A] GGAGAAGTCTGCCGTTACTGCCCTG (Strand: -)

External Links

Location

Chromosome: 11
Locus: NG_000007.3
Locus Location: 70614
Size: 1 bp
Located at: β
Specific Location: Exon 1

Phenotype

Hemoglobinopathy Group: Thalassaemia
Hemoglobinopathy Subgroup: β-thalassaemia
Allele Phenotype:β0
Associated Phenotypes: Haemolytic anaemia [HP:0001878]
Ineffective erythropoiesis [HP:0010972]

Other details

Type of Mutation: Point-Mutation(Deletion)
Effect on Gene/Protein Function: Frameshift (Translation)
Ethnic Origin: Mediterranean, African-American
Inheritance: Recessive
DNA Sequence Determined: No
Detection Methods: MLPA

Sequence Viewer

Note: The NCBI Sequence Viewer is not installed on the ITHANET servers but it is embedded in this page from the NCBI. Therefore, IthaGenes has no responsibility over any temporary unavailability of the service. In such a case, please Refresh the page or retry at a later stage. Otherwise, use this external link.

Frequencies

Publications / Origin

  1. Chang JC, Alberti A, Kan YW, A beta-thalassemia lesion abolishes the same Mst II site as the sickle mutation., Nucleic acids research, 11(22), 7789-94, 1983 PubMed
  2. Kazazian HH, Orkin SH, Boehm CD, Sexton JP, Antonarakis SE, beta-Thalassemia due to a deletion of the nucleotide which is substituted in the beta S-globin gene., American journal of human genetics, 35(5), 1028-33, 1983 PubMed
  3. Gonzalez-Redondo JM, Stoming TA, Lanclos KD, Gu YC, Kutlar A, Kutlar F, Nakatsuji T, Deng B, Han IS, McKie VC, Clinical and genetic heterogeneity in black patients with homozygous beta-thalassemia from the southeastern United States., Blood, 72(3), 1007-14, 1988 PubMed
  4. Petkov GH, Efremov GD, Efremov DG, Dimovski A, Tchaicarova P, Tchaicarov R, Rogina B, Agarwal S, Kutlar A, Kutlar F, Beta-thalassemia in Bulgaria., Hemoglobin, 14(1), 25-33, 1990 PubMed
Created on 2010-06-16 16:13:14, Last reviewed on 2014-04-30 09:31:16 (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.

Please publish modules in offcanvas position.