IthaID: 53



Names and Sequences

Functionality: Globin gene causative mutation Pathogenicity: N/A
Common Name: CD 2/3 (+T); CD 5 (-C) HGVS Name: HBB:c.[9dupT; 17delC]
Hb Name: Hb Antalya Protein Info: β 2 - 5 His-Leu-Thr-Pro replaced with His-Ser-Asp-Ser
Also known as:

We follow the HGVS sequence variant nomenclature and IUPAC standards.

Context nucleotide sequence:
AACAGACACCATGGTGCAT[-/T]CTGACTC [-/C] TGAGGAGAAGTCTGCCGTTACTGC (Strand: -)

Comments: Found in a proband with beta-thalassaemia trait. The amino acid residues Leu-Thr-Pro (codons 3-5) of the normal allele in the β-globin gene are changed to Ser-Asp-Ser, respectively, by insertion of a nt T between codon 2 and codon 3 (CAT [+T] CTG) and deletion of a nt C at codon 5 (CCT>C-T).

Phenotype

Hemoglobinopathy Group: Thalassaemia and Structural Haemoglobinopathy
Hemoglobinopathy Subgroup: β-thalassaemia, β-chain variant
Allele Phenotype:β+
Thalassaemia
Dominant
Stability: Hyperunstable
Oxygen Affinity: N/A
Associated Phenotypes: Haemolytic anaemia [HP:0001878]
Ineffective erythropoiesis [HP:0010972]

Location

Chromosome: 11
Locus: NG_000007.3
Locus Location: 70603 or 70611
Size: 1 bp or 1 bp
Located at: β
Specific Location: Exon 1

Other details

Type of Mutation: Point-Mutation(Deletion)
Effect on Gene/Protein Function: Insertion/Deletion of codons (Protein Structure)
Ethnic Origin: Turkish
Molecular mechanism: N/A
Inheritance: Dominant
DNA Sequence Determined: Yes

In silico pathogenicity prediction

Sequence Viewer

Note: The NCBI Sequence Viewer is not installed on the ITHANET servers but it is embedded in this page from the NCBI. Therefore, IthaGenes has no responsibility over any temporary unavailability of the service. In such a case, please Refresh the page or retry at a later stage. Otherwise, use this external link.

Publications / Origin

  1. Keser I, Kayisli OG, Yesilipek A, Ozes ON, Luleci G, Hb Antalya [codons 3-5 (Leu-Thr-Pro-->Ser-Asp-Ser)]: a new unstable variant leading to chronic microcytic anemia and high Hb A2., Hemoglobin, 25(4), 369-73, 2001 PubMed
Created on 2010-06-16 16:13:14, Last reviewed on 2024-04-29 12:50:12 (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.