IthaID: 516



Names and Sequences

Functionality: Globin gene causative mutation Pathogenicity: N/A
Common Name: CD 37 +GAA [+Glu] HGVS Name: HBA1:c.114_115insGAA | HBA2:c.114_115insGAA
Hb Name: Hb Catonsville Protein Info: Glu- inserted between codons 37(C2) and 38(C3) of α1 or α2

Context nucleotide sequence:
CCGCAGGATGTTCCTGTCCTTCCCC [-/GAA] ACCACCAAGACCTACTTCCCGCACT (Strand: +)

Also known as:

We follow the HGVS sequence variant nomenclature and IUPAC standards.

External Links

Phenotype

Hemoglobinopathy Group: Structural Haemoglobinopathy
Hemoglobinopathy Subgroup: α-chain variant
Allele Phenotype:N/A
Stability: Unstable
Oxygen Affinity: Increased Oxygen Affinity
Associated Phenotypes: N/A

Location

Chromosome: 16
Locus: NG_000006.1
Locus Location: 34006 or 37810
Size: 3 bp or 3 bp
Located at: α1 or α2
Specific Location: Exon 2

Other details

Type of Mutation: Point-Mutation(Insertion)
Effect on Gene/Protein Function: Insertion/Deletion of codons (Protein Structure)
Ethnic Origin: N/A
Molecular mechanism: N/A
Inheritance: Recessive
DNA Sequence Determined: No

In silico pathogenicity prediction

Sequence Viewer

Note: The NCBI Sequence Viewer is not installed on the ITHANET servers but it is embedded in this page from the NCBI. Therefore, IthaGenes has no responsibility over any temporary unavailability of the service. In such a case, please Refresh the page or retry at a later stage. Otherwise, use this external link.

Publications / Origin

  1. Moo-Penn WF, Swan DC, Hine TK, Baine RM, Jue DL, Benson JM, Johnson MH, Virshup DM, Zinkham WH, Hb Catonsville (glutamic acid inserted between Pro-37(C2)alpha and Thr-38(C3)alpha). Nonallelic gene conversion in the globin system?, J. Biol. Chem. , 264(36), 21454-7, 1989 PubMed
  2. Dash S, Das R, Late emergence of polycythemia in a case of Hb Chandigarh [beta94(FG1)Asp-->Gly]., Hemoglobin , 28(3), 273-4, 2004 PubMed
Created on 2010-06-16 16:13:15, Last reviewed on 2017-06-14 12:38:39 (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.