IthaID: 516
Names and Sequences
| Functionality: | Globin gene causative mutation | Pathogenicity: | N/A |
|---|---|---|---|
| Common Name: | CD 37 +GAA [+Glu] | HGVS Name: | HBA1:c.114_115insGAA | HBA2:c.114_115insGAA |
| Hb Name: | Hb Catonsville | Protein Info: | Glu- inserted between codons 37(C2) and 38(C3) of α1 or α2 |
Context nucleotide sequence:
CCGCAGGATGTTCCTGTCCTTCCCC [-/GAA] ACCACCAAGACCTACTTCCCGCACT (Strand: +)
Also known as:
We follow the HGVS sequence variant nomenclature and IUPAC standards.
Phenotype
| Hemoglobinopathy Group: | Structural Haemoglobinopathy |
|---|---|
| Hemoglobinopathy Subgroup: | α-chain variant |
| Allele Phenotype: | N/A |
| Stability: | Unstable |
| Oxygen Affinity: | Increased Oxygen Affinity |
| Associated Phenotypes: | N/A |
Location
| Chromosome: | 16 |
|---|---|
| Locus: | NG_000006.1 |
| Locus Location: | 34006 or 37810 |
| Size: | 3 bp or 3 bp |
| Located at: | α1 or α2 |
| Specific Location: | Exon 2 |
Other details
| Type of Mutation: | Point-Mutation(Insertion) |
|---|---|
| Effect on Gene/Protein Function: | Insertion/Deletion of codons (Protein Structure) |
| Ethnic Origin: | N/A |
| Molecular mechanism: | N/A |
| Inheritance: | Recessive |
| DNA Sequence Determined: | No |
In silico pathogenicity prediction
Note:
The impact thresholds provided in this section are based on the analyses performed in Tamana et.al. For any given tool, the impact thresholds defined for the set of variants with the same effect on function as the variant examined, are preferred over those defined for the full dataset.
Sequence Viewer
Note: The NCBI Sequence Viewer is not installed on the ITHANET servers but it is embedded in this page from the NCBI.
Therefore, IthaGenes has no responsibility over any temporary unavailability of the service.
In such a case, please Refresh the page or retry at a later stage.
Otherwise, use this external link.
Publications / Origin
- Moo-Penn WF, Swan DC, Hine TK, Baine RM, Jue DL, Benson JM, Johnson MH, Virshup DM, Zinkham WH, Hb Catonsville (glutamic acid inserted between Pro-37(C2)alpha and Thr-38(C3)alpha). Nonallelic gene conversion in the globin system?, J. Biol. Chem. , 264(36), 21454-7, 1989 PubMed
- Dash S, Das R, Late emergence of polycythemia in a case of Hb Chandigarh [beta94(FG1)Asp-->Gly]., Hemoglobin , 28(3), 273-4, 2004 PubMed
Created on 2010-06-16 16:13:15,
Last reviewed on 2017-06-14 12:38:39 (Show full history)
| A/A | Date | Curator(s) | Comments |
|---|---|---|---|
| 1 | 2010-06-16 16:13:15 | The IthaGenes Curation Team | Created |
| 2 | 2014-03-13 13:37:23 | The IthaGenes Curation Team | Reviewed. |
| 3 | 2017-06-14 12:38:39 | The IthaGenes Curation Team | Reviewed. Reference added. |
Disclaimer: The information on this website is provided as an information resource only
and must not to be used as a substitute for professional diagnosis and treatment.
The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment,
diagnosis or any other information, services or products that an individual obtains through this website.
IthaGenes was last updated on 2024-11-20 13:24:07