IthaID: 427



Names and Sequences

Functionality: Globin gene causative mutation Pathogenicity: Pathogenic / Likely Pathogenic
Common Name: Poly A (AATAAA>AATAAC) HGVS Name: HBA2:c.*94A>C
Hb Name: N/A Protein Info: α2 nt 819 A>C

Context nucleotide sequence:
CCGGCCCTTCCTGGTCTTTGAATAA [A/C/G] GTCTGAGTGGGCGGCAGCCTGTGTG (Strand: +)

Also known as:

External Links

Phenotype

Hemoglobinopathy Group: Thalassaemia
Hemoglobinopathy Subgroup: α-thalassaemia
Allele Phenotype:α+/α0
Associated Phenotypes: Haemolytic anaemia [HP:0001878]

Location

Chromosome: 16
Locus: NG_000006.1
Locus Location: 34557
Size: 1 bp
Located at: α2
Specific Location: Poly(A)

Other details

Type of Mutation: Point-Mutation(Substitution)
Effect on Gene/Protein Function: RNA cleavage - Poly(A) signal (mRNA Processing)
Ethnic Origin: Surinam
Molecular mechanism: N/A
Inheritance: Recessive
DNA Sequence Determined: No

Sequence Viewer

Note: The NCBI Sequence Viewer is not installed on the ITHANET servers but it is embedded in this page from the NCBI. Therefore, IthaGenes has no responsibility over any temporary unavailability of the service. In such a case, please Refresh the page or retry at a later stage. Otherwise, use this external link.

Publications / Origin

  1. Harteveld CL, Oosterhuis WP, Schoenmakers CH, Ananta H, Kos S, Bakker Verweij M, van Delft P, Arkesteijn SG, Phylipsen M, Giordano PC, alpha-thalassaemia masked by beta gene defects and a new polyadenylation site mutation on the alpha2-globin gene., European journal of haematology, 84(4), 354-8, 2010 PubMed
Created on 2010-06-16 16:13:15, Last reviewed on 2020-10-02 10:24:34 (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.