IthaID: 425

Names and Sequences

Functionality:	Globin gene causative mutation	Pathogenicity:	Pathogenic / Likely Pathogenic
Common Name:	Poly A (AATAAA>AATGAA)	HGVS Name:	HBA2:c.*92A>G
Hb Name:	N/A	Protein Info:	α2 nt 817 A>G

Context nucleotide sequence:
CACCGGCCCTTCCTGGTCTTTGAAT [A/G] AAGTCTGAGTGGGCAGCAGCCTGTG (Strand: +)

Also known as: αPolyA2

We follow the HGVS sequence variant nomenclature and IUPAC standards.

External Links

HbVar	dbSNP
OMIM

Phenotype

Hemoglobinopathy Group:	Thalassaemia
Hemoglobinopathy Subgroup:	α-thalassaemia
Allele Phenotype:	α+/α0
Associated Phenotypes:	Haemolytic anaemia [HP:0001878]

IthaPhen

Heterozygous records (preview in IthaPhen)

Location

Chromosome:	16
Locus:	NG_000006.1
Locus Location:	34555
Size:	1 bp
Located at:	α2
Specific Location:	Poly(A)

Other details

Type of Mutation:	Point-Mutation(Substitution)
Effect on Gene/Protein Function:	RNA cleavage - Poly(A) signal (mRNA Processing)
Ethnic Origin:	Mediterranean, Turkish, Cypriot, UAE, Iranian
Molecular mechanism:	N/A
Inheritance:	Recessive
DNA Sequence Determined:	No

In silico pathogenicity prediction

Sequence Viewer

Note: The NCBI Sequence Viewer is not installed on the ITHANET servers but it is embedded in this page from the NCBI. Therefore, IthaGenes has no responsibility over any temporary unavailability of the service. In such a case, please Refresh the page or retry at a later stage. Otherwise, use this external link.

Frequencies

Publications / Origin

Yüregir GT, Aksoy K, Cürük MA, Dikmen N, Fei YJ, Baysal E, Huisman TH, Hb H disease in a Turkish family resulting from the interaction of a deletional alpha-thalassaemia-1 and a newly discovered poly A mutation., British journal of haematology, 80(4), 527-32, 1992 PubMed
Baysal E, Kleanthous M, Bozkurt G, Kyrri A, Kalogirou E, Angastiniotis M, Ioannou P, Huisman TH, alpha-Thalassaemia in the population of Cyprus., Br. J. Haematol. , 89(3), 496-9, 1995 PubMed
Kyriacou K, Kyrri A, Kalogirou E, Vasiliades P, Angastiniotis M, Ioannou PA, Kleanthous M, Hb Bart's levels in cord blood and alpha-thalassemia mutations in Cyprus., Hemoglobin , 24(3), 171-80, 2000 PubMed
Ma ES, Chow EY, Chan AY, Chan LC, Interaction between (--SEA) alpha-thalassemia deletion and uncommon non-deletional alpha-globin gene mutations in Chinese patients., Haematologica , 86(5), 539-40, 2001 PubMed
Hadavi V, Taromchi AH, Malekpour M, Gholami B, Law HY, Almadani N, Afroozan F, Sahebjam F, Pajouh P, Kariminejad R, Kariminejad MH, Azarkeivan A, Jafroodi M, Tamaddoni A, Puehringer H, Oberkanins C, Najmabadi H, Elucidating the spectrum of alpha-thalassemia mutations in Iran., Haematologica , 92(7), 992-3, 2007 PubMed
Akhavan-Niaki H, Youssefi Kamangari R, Banihashemi A, Kholghi Oskooei V, Azizi M, Tamaddoni A, Sedaghat S, Vakili M, Mahmoudi Nesheli H, Shabani S, Hematologic features of alpha thalassemia carriers., Int J Mol Cell Med , 1(3), 162-7, 2012 PubMed

Created on 2010-06-16 16:13:15, Last reviewed on 2020-10-02 10:23:28 (Show full history)

A/A	Date	Curator(s)	Comments
1	2010-06-16 16:13:15	The IthaGenes Curation Team	Created
2	2013-10-15 17:28:32	The IthaGenes Curation Team	Reviewed.
3	2014-04-08 17:52:47	The IthaGenes Curation Team	Reviewed.
4	2014-10-20 11:00:35	The IthaGenes Curation Team	Reviewed.
5	2014-10-21 12:32:12	The IthaGenes Curation Team	Reviewed. Publication list updated.
6	2020-10-02 10:23:28	The IthaGenes Curation Team	Reviewed. Name edits.

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.