IthaID: 424



Names and Sequences

Functionality: Globin gene causative mutation Pathogenicity: Pathogenic / Likely Pathogenic
Common Name: Poly A (AATAAA>AATAAG) HGVS Name: HBA2:c.*94A>G
Hb Name: N/A Protein Info: α2 nt 819 A>G
Also known as: αPolyA1, αT-Saudi

We follow the HGVS sequence variant nomenclature and IUPAC standards.

Context nucleotide sequence:
CCGGCCCTTCCTGGTCTTTGAATAA [A/C/G] GTCTGAGTGGGCGGCAGCCTGTGTG (Strand: +)

External Links

Phenotype

Hemoglobinopathy Group: Thalassaemia
Hemoglobinopathy Subgroup: α-thalassaemia
Allele Phenotype:α+/α0
Associated Phenotypes: Haemolytic anaemia [HP:0001878]

Location

Chromosome: 16
Locus: NG_000006.1
Locus Location: 34557
Size: 1 bp
Located at: α2
Specific Location: Poly(A)

Other details

Type of Mutation: Point-Mutation(Substitution)
Effect on Gene/Protein Function: RNA cleavage - Poly(A) signal (mRNA Processing)
Ethnic Origin: Arab, Middle East, Mediterranean
Molecular mechanism: N/A
Inheritance: Recessive
DNA Sequence Determined: No

In silico pathogenicity prediction

Sequence Viewer

Note: The NCBI Sequence Viewer is not installed on the ITHANET servers but it is embedded in this page from the NCBI. Therefore, IthaGenes has no responsibility over any temporary unavailability of the service. In such a case, please Refresh the page or retry at a later stage. Otherwise, use this external link.

Frequencies

Publications / Origin

  1. Higgs DR, Goodbourn SE, Lamb J, Clegg JB, Weatherall DJ, Proudfoot NJ, Alpha-thalassaemia caused by a polyadenylation signal mutation., Nature , 306(5941), 398-400, 1983 PubMed
  2. Whitelaw E, Proudfoot N, Alpha-thalassaemia caused by a poly(A) site mutation reveals that transcriptional termination is linked to 3' end processing in the human alpha 2 globin gene., EMBO J. , 5(11), 2915-22, 1986 PubMed
  3. Thein SL, Wallace RB, Pressley L, Clegg JB, Weatherall DJ, Higgs DR, The polyadenylation site mutation in the alpha-globin gene cluster., Blood , 71(2), 313-9, 1988 PubMed
  4. Fei YJ, Oner R, Bözkurt G, Gu LH, Altay C, Gurgey A, Fattoum S, Baysal E, Huisman TH, Hb H disease caused by a homozygosity for the AATAAA-->AATAAG mutation in the polyadenylation site of the alpha 2-globin gene: hematological observations., Acta Haematol. , 88(2), 82-5, 1992 PubMed
  5. Adekile AD, Gu LH, Baysal E, Haider MZ, al-Fuzae L, Aboobacker KC, al-Rashied A, Huisman TH, Molecular characterization of alpha-thalassemia determinants, beta-thalassemia alleles, and beta S haplotypes among Kuwaiti Arabs., Acta Haematol. , 92(4), 176-81, 1994 PubMed
  6. Viprakasit V, Green S, Height S, Ayyub H, Higgs DR, Hb H hydrops fetalis syndrome associated with the interaction of two common determinants of alpha thalassaemia (--MED/(alpha)TSaudi(alpha))., Br. J. Haematol. , 117(3), 759-62, 2002 PubMed
  7. Baysal E, α-Thalassemia syndromes in the United Arab Emirates., Hemoglobin , 35(5), 574-80, 2011 PubMed
Created on 2010-06-16 16:13:15, Last reviewed on 2020-10-02 10:23:44 (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.