IthaID: 416
Names and Sequences
| Functionality: | Globin gene causative mutation | Pathogenicity: | Pathogenic / Likely Pathogenic |
|---|---|---|---|
| Common Name: | CD 131 (+T) >175aa | HGVS Name: | HBA1:c.396dup |
| Hb Name: | Hb Pak Num Po | Protein Info: | α1 131(+T); modified C-terminal sequence: (132)Cys-Glu-His-Arg-Ala-Asp-Leu-Gln- Ile-Pro-Leu-Ser-Trp-Ser-Leu-Gly-Gly-His- Ala-Ser-Cys-Pro-Leu-Gly-Leu-Pro-Pro-Ala- Pro-Pro-Pro-Leu-Pro-Ala-Pro-Val-Pro-Pro- Trp-Ser-Leu-Asn-Lys-(175)Val-COOH |
Context nucleotide sequence:
CTCCCTGGACAAGTTCCTGGCTTCT [-/T] GTGAGCACCGTGCTGACCTCCAAAT (Strand: +)
Also known as:
Comments: Found in compound heterozygosity with the –SEA deletion [IthaID:309] leading to Hb H disease. Also, patient with Hb Pak Num Po and the deletional mutation -α4.2 [IthaID:301] presented with mild hypochromic microcytic anemia and required no blood transfusions.
We follow the HGVS sequence variant nomenclature and IUPAC standards.
Phenotype
| Hemoglobinopathy Group: | Thalassaemia and Structural Haemoglobinopathy |
|---|---|
| Hemoglobinopathy Subgroup: | α-thalassaemia, α-chain variant |
| Allele Phenotype: | α⁺ |
| Stability: | Hyperunstable |
| Oxygen Affinity: | N/A |
| Associated Phenotypes: | Haemolytic anaemia [HP:0001878] |
Location
| Chromosome: | 16 |
|---|---|
| Locus: | NG_000006.1 |
| Locus Location: | 38241 |
| Size: | 1 bp |
| Located at: | α1 |
| Specific Location: | Exon 3 |
Other details
| Type of Mutation: | Point-Mutation(Insertion) |
|---|---|
| Effect on Gene/Protein Function: | Frameshift (Translation) |
| Ethnic Origin: | Thai |
| Molecular mechanism: | N/A |
| Inheritance: | Recessive |
| DNA Sequence Determined: | Yes |
In silico pathogenicity prediction
Note:
The impact thresholds provided in this section are based on the analyses performed in Tamana et.al. For any given tool, the impact thresholds defined for the set of variants with the same effect on function as the variant examined, are preferred over those defined for the full dataset.
Sequence Viewer
Note: The NCBI Sequence Viewer is not installed on the ITHANET servers but it is embedded in this page from the NCBI.
Therefore, IthaGenes has no responsibility over any temporary unavailability of the service.
In such a case, please Refresh the page or retry at a later stage.
Otherwise, use this external link.
Publications / Origin
- Viprakasit V, Tanphaichitr VS, Veerakul G, Chinchang W, Petrarat S, Pung-Amritt P, Higgs DR, Co-inheritance of Hb Pak Num Po, a novel alpha1 gene mutation, and alpha0 thalassemia associated with transfusion-dependent Hb H disease., American journal of hematology, 75(3), 157-63, 2004 PubMed
- Sanpakit K, Viprakasit V, Variable genotype-phenotype correlations in patients with a rare nondeletional α-thalassemia; Hb Pak Num Po (HBA1: c.396_397insT)., J Pediatr Hematol Oncol, 36(3), e185-9, 2014 PubMed
Created on 2010-06-16 16:13:15,
Last reviewed on 2022-02-28 09:18:20 (Show full history)
| A/A | Date | Curator(s) | Comments |
|---|---|---|---|
| 1 | 2010-06-16 16:13:15 | The IthaGenes Curation Team | Created |
| 2 | 2013-10-15 17:00:14 | The IthaGenes Curation Team | Reviewed. |
| 3 | 2017-06-01 16:04:25 | The IthaGenes Curation Team | Reviewed. Allele phenotype and Other details sections updated. |
| 4 | 2022-02-28 09:18:20 | The IthaGenes Curation Team | Reviewed. HGVS and allele phenotype corrected. Comment and referene added. |
Disclaimer: The information on this website is provided as an information resource only
and must not to be used as a substitute for professional diagnosis and treatment.
The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment,
diagnosis or any other information, services or products that an individual obtains through this website.
IthaGenes was last updated on 2024-11-20 13:24:07