IthaID: 4111



Names and Sequences

Functionality: Globin gene causative mutation Pathogenicity: N/A
Common Name: Poly A (AATAAA>AAΑΑΑ) HGVS Name: HBA2:c.*91delT
Hb Name: N/A Protein Info: α2 nt 816 delT
Also known as:

We follow the HGVS sequence variant nomenclature and IUPAC standards.

Context nucleotide sequence:
GCACCGGCCCTTCCTGGTCTTTGAA [T/-] AAAGTCTGAGTGGGCAGCAGCCTGTG (Strand: +)

Comments: Found as a novel mutation in a Chinese patient, in compound heterozygosity with –SEA [IthaID: 309], leading to severe non-deletional Hb H disease with blood transfusion dependence since infancy.

External Links

No available links

Phenotype

Hemoglobinopathy Group: Thalassaemia
Hemoglobinopathy Subgroup: α-thalassaemia
Allele Phenotype:α+/α0
Associated Phenotypes: N/A

Location

Chromosome: 16
Locus: NG_000006.1
Locus Location: 34554
Size: 1 bp
Located at: α2
Specific Location: Poly(A)

Other details

Type of Mutation: Point-Mutation(Substitution)
Effect on Gene/Protein Function: RNA cleavage - Poly(A) signal (mRNA Processing)
Ethnic Origin: Chinese
Molecular mechanism: N/A
Inheritance: Recessive
DNA Sequence Determined: Yes

In silico pathogenicity prediction

Sequence Viewer

Note: The NCBI Sequence Viewer is not installed on the ITHANET servers but it is embedded in this page from the NCBI. Therefore, IthaGenes has no responsibility over any temporary unavailability of the service. In such a case, please Refresh the page or retry at a later stage. Otherwise, use this external link.

Publications / Origin

  1. Ren ZM, Li WJ, Xing ZH, Fu XY, Zhang JY, Chen YS, Li DF, Detecting rare thalassemia in children with anemia using third-generation sequencing., Hematology, 28(1), 2241226, 2023 PubMed
Created on 2024-10-23 15:23:06, Last reviewed on (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.