IthaID: 4104



Names and Sequences

Functionality: Globin gene causative mutation Pathogenicity: N/A
Common Name: CD 147 TAA>ΑAC [Stop>Tyr] HGVS Name: HBB:c.444A>C
Hb Name: N/A Protein Info: β 147, Stop>Tyr; modified C-terminal sequence: (147)Tyr-Ala-Arg-Phe-Leu-Ala-Val-Gln-Phe-Leu-Leu- Lys-Val-Pro-Leu-Phe-Pro-Lys-Ser-Asn-(167)Tyr-COOH
Also known as:

We follow the HGVS sequence variant nomenclature and IUPAC standards.

Context nucleotide sequence:
AATGCCCTGGCCCACAAGTATCACTA [A/C] GCTCGCTTTCTTGCTGTCCAATTTCT (Strand: -)

Comments: Reported as a de novo mutation in a 2-month-old infant girl, presented with persistent jaundice and failure to thrive. The infant was diagnosed with β-thalassemia. This mutation results in a stop-codon substitution to a tyrosine residue and an increase of 21 amino-acids in the β-globin chain that probably makes the protein unstable. Leads to a dominant beta-thalassemia state according to this case report.

External Links

No available links

Phenotype

Hemoglobinopathy Group: Thalassaemia
Hemoglobinopathy Subgroup: β-thalassaemia
Allele Phenotype:N/A
Associated Phenotypes: N/A

Location

Chromosome: 11
Locus: NG_000007.3
Locus Location: 72018
Size: 1 bp
Located at: β
Specific Location: Exon 3

Other details

Type of Mutation: Point-Mutation(Substitution)
Effect on Gene/Protein Function: Nonsense codon (Translation)
Ethnic Origin: Danish
Molecular mechanism: N/A
Inheritance: Dominant
DNA Sequence Determined: Yes

In silico pathogenicity prediction

Sequence Viewer

Note: The NCBI Sequence Viewer is not installed on the ITHANET servers but it is embedded in this page from the NCBI. Therefore, IthaGenes has no responsibility over any temporary unavailability of the service. In such a case, please Refresh the page or retry at a later stage. Otherwise, use this external link.

Publications / Origin

  1. Ravichandran S, Hoffmann M, Petersen J, Sjø L, Rasmussen AØ, Eidesgaard A, Glenthøj A, A Rare Case of Beta-Thalassemia Diagnosed by Whole-Genome Sequencing in an Ethnically Danish Newborn., Hemoglobin, 2024 PubMed
Created on 2024-07-23 16:18:31, Last reviewed on 2024-07-23 16:21:36 (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.