IthaID: 4104
Names and Sequences
| Functionality: | Globin gene causative mutation | Pathogenicity: | N/A |
|---|---|---|---|
| Common Name: | CD 147 TAA>ΑAC [Stop>Tyr] | HGVS Name: | HBB:c.444A>C |
| Hb Name: | N/A | Protein Info: | β 147, Stop>Tyr; modified C-terminal sequence: (147)Tyr-Ala-Arg-Phe-Leu-Ala-Val-Gln-Phe-Leu-Leu- Lys-Val-Pro-Leu-Phe-Pro-Lys-Ser-Asn-(167)Tyr-COOH |
Context nucleotide sequence:
AATGCCCTGGCCCACAAGTATCACTA [A/C] GCTCGCTTTCTTGCTGTCCAATTTCT (Strand: -)
Also known as:
Comments: Reported as a de novo mutation in a 2-month-old infant girl, presented with persistent jaundice and failure to thrive. The infant was diagnosed with β-thalassemia. This mutation results in a stop-codon substitution to a tyrosine residue and an increase of 21 amino-acids in the β-globin chain that probably makes the protein unstable. Leads to a dominant beta-thalassemia state according to this case report.
We follow the HGVS sequence variant nomenclature and IUPAC standards.
External Links
No available links
Phenotype
| Hemoglobinopathy Group: | Thalassaemia |
|---|---|
| Hemoglobinopathy Subgroup: | β-thalassaemia |
| Allele Phenotype: | N/A |
| Associated Phenotypes: | N/A |
Location
| Chromosome: | 11 |
|---|---|
| Locus: | NG_000007.3 |
| Locus Location: | 72018 |
| Size: | 1 bp |
| Located at: | β |
| Specific Location: | Exon 3 |
Other details
| Type of Mutation: | Point-Mutation(Substitution) |
|---|---|
| Effect on Gene/Protein Function: | Nonsense codon (Translation) |
| Ethnic Origin: | Danish |
| Molecular mechanism: | N/A |
| Inheritance: | Dominant |
| DNA Sequence Determined: | Yes |
In silico pathogenicity prediction
Note:
The impact thresholds provided in this section are based on the analyses performed in Tamana et.al. For any given tool, the impact thresholds defined for the set of variants with the same effect on function as the variant examined, are preferred over those defined for the full dataset.
Sequence Viewer
Note: The NCBI Sequence Viewer is not installed on the ITHANET servers but it is embedded in this page from the NCBI.
Therefore, IthaGenes has no responsibility over any temporary unavailability of the service.
In such a case, please Refresh the page or retry at a later stage.
Otherwise, use this external link.
Publications / Origin
- Ravichandran S, Hoffmann M, Petersen J, Sjø L, Rasmussen AØ, Eidesgaard A, Glenthøj A, A Rare Case of Beta-Thalassemia Diagnosed by Whole-Genome Sequencing in an Ethnically Danish Newborn., Hemoglobin, 2024 PubMed
Created on 2024-07-23 16:18:31,
Last reviewed on 2024-07-23 16:21:36 (Show full history)
| A/A | Date | Curator(s) | Comments |
|---|---|---|---|
| 1 | 2024-07-23 16:18:31 | The IthaGenes Curation Team | Created |
| 2 | 2024-07-23 16:21:36 | The IthaGenes Curation Team | Reviewed. Protein info added. |
Disclaimer: The information on this website is provided as an information resource only
and must not to be used as a substitute for professional diagnosis and treatment.
The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment,
diagnosis or any other information, services or products that an individual obtains through this website.
IthaGenes was last updated on 2024-11-20 13:24:07