IthaID: 4086



Names and Sequences

Functionality: Globin gene causative mutation Pathogenicity: N/A
Common Name: CD 59 AAG>AA-, CD 59 (-G) HGVS Name: HBB:c.180del
Hb Name: N/A Protein Info: N/A

Context nucleotide sequence:
CTGATGCTGTTATGGGCAACCCTAA [G/-] GTGAAGGCTCATGGCAAGAAAGTGC (Strand: -)

Also known as:

Comments: The deletion of nt 'G' in codon 59 causes a frameshift and premature termination of the encoded peptide in codon 60. Associated with a beta thalassemia trait phenotype in the heterozygous state.

We follow the HGVS sequence variant nomenclature and IUPAC standards.

External Links

Phenotype

Hemoglobinopathy Group: Thalassaemia
Hemoglobinopathy Subgroup: β-thalassaemia
Allele Phenotype:N/A
Associated Phenotypes: N/A

Location

Chromosome: 11
Locus: NG_000007.3
Locus Location: 70904
Size: 1 bp
Located at: β
Specific Location: Exon 2

Other details

Type of Mutation: Point-Mutation(Deletion)
Effect on Gene/Protein Function: Frameshift (Translation)
Ethnic Origin: Chinese
Molecular mechanism: N/A
Inheritance: Recessive
DNA Sequence Determined: Yes

In silico pathogenicity prediction

Sequence Viewer

Note: The NCBI Sequence Viewer is not installed on the ITHANET servers but it is embedded in this page from the NCBI. Therefore, IthaGenes has no responsibility over any temporary unavailability of the service. In such a case, please Refresh the page or retry at a later stage. Otherwise, use this external link.

Publications / Origin

  1. Bao X, Qin D, Wang J, Chen J, Yao C, Liang J, Liang K, Wang Y, Wang Y, Du L, Yin A, Two novel deletion mutations in β-globin gene cause β-thalassemia trait in two Chinese families., Hum Genomics, 17(1), 111, 2023 PubMed
Created on 2023-12-19 09:30:31, Last reviewed on (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.