IthaID: 4068

Names and Sequences

Functionality:	Globin gene causative mutation	Pathogenicity:	N/A
Common Name:	CD 112 CAC>-AC	HGVS Name:	HBA2:c.337delC
Hb Name:	N/A	Protein Info:	N/A

Context nucleotide sequence:
CTGCCTGCTGGTGACCCTGGCCGCC [C/-] ACCTCCCCGCCGAGTTCACCCCT (Strand: +)

Also known as:

Comments: The deletion of a nucleotide 'C' in exon 3 of the α2-globin gene causes a frameshift resulting in a premature termination codon (TGA) at codon 132. Found via next generation sequencing and confirmed by Sanger sequencing. No other variations in HBB, HBA2 and HBA1 genes were detected. The proband had normal Hb (119 g/L), but a slightly decreased mean corpuscular volume (MCV, 77.2 fL) and mean corpuscular hemoglobin (MCH, 25.6 pg). Also, Hb A (97.8%) and Hb F (0.0%) values by CE (Capillarys 2 FIEX PIERCING, Sebia) were normal, while the Hb A2 (2.2%) value was below normal, which indicates a phenotype of silent α-thalassemia.

We follow the HGVS sequence variant nomenclature and IUPAC standards.

External Links

No available links

Phenotype

Hemoglobinopathy Group:	Thalassaemia
Hemoglobinopathy Subgroup:	α-thalassaemia
Allele Phenotype:	α⁺
Associated Phenotypes:	N/A

IthaPhen

Heterozygous records (preview in IthaPhen)

Location

Chromosome:	16
Locus:	NG_000006.1
Locus Location:	34371
Size:	1 bp
Located at:	α2
Specific Location:	Exon 3

Other details

Type of Mutation:	Point-Mutation(Deletion)
Effect on Gene/Protein Function:	Frameshift (Translation)
Ethnic Origin:	Chinese
Molecular mechanism:	N/A
Inheritance:	Recessive
DNA Sequence Determined:	Yes

In silico pathogenicity prediction

Sequence Viewer

Note: The NCBI Sequence Viewer is not installed on the ITHANET servers but it is embedded in this page from the NCBI. Therefore, IthaGenes has no responsibility over any temporary unavailability of the service. In such a case, please Refresh the page or retry at a later stage. Otherwise, use this external link.

Publications / Origin

To the best of our knowledge, this is unpublished data. Please use with caution!

Microattributions

A/A	Contributor(s)	Date	Comments
1	Pan, Lei	2023-09-11	First report.

Created on 2023-09-26 10:39:16, Last reviewed on 2023-09-26 12:31:40 (Show full history)

A/A	Date	Curator(s)	Comments
1	2023-09-26 10:39:16	The IthaGenes Curation Team	Created
2	2023-09-26 12:31:40	The IthaGenes Curation Team	Reviewed. DNA info corrected

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.