IthaID: 4026
Names and Sequences
| Functionality: | Globin gene causative mutation | Pathogenicity: | N/A |
|---|---|---|---|
| Common Name: | CD 46 GGG>CGG [Gly>Arg], IVS II-456 A>G | HGVS Name: | HBD:c.[139G>C;316-443A>G] |
| Hb Name: | Hb A2-Malay | Protein Info: | N/A |
Context nucleotide sequence:
GGACCCAGAGGTTCTTTGAGTCCTTT [G>C] GGGATCTGTCCTCTCCTGATGCTGTT (Strand: -)
Also known as:
Comments: CD 46 G>C nucleotide substitution is found together with IVS II-456 A>G in six Malay individuals. One individual also carried Asian-Indian Inv/Del Gγ(Aγδβ)0 [IthaID: 1519]. It is hypothesized that CD 46 G>C and IVS II-456 A>G occur on the same allele since this individual carries a deletion on the other allele.
We follow the HGVS sequence variant nomenclature and IUPAC standards.
External Links
No available links
Phenotype
| Hemoglobinopathy Group: | Thalassaemia |
|---|---|
| Hemoglobinopathy Subgroup: | δ-thalassaemia |
| Allele Phenotype: | N/A |
| Associated Phenotypes: | N/A |
Location
| Chromosome: | 11 |
|---|---|
| Locus: | NG_000007.3 |
| Locus Location: | 63449 or 64081 |
| Size: | 1 bp or 1 bp |
| Located at: | δ |
| Specific Location: | Exon 2 |
Other details
| Type of Mutation: | Point-Mutation(Substitution) |
|---|---|
| Effect on Gene/Protein Function: | N/A |
| Ethnic Origin: | Malay |
| Molecular mechanism: | N/A |
| Inheritance: | Recessive |
| DNA Sequence Determined: | Yes |
In silico pathogenicity prediction
Note:
The impact thresholds provided in this section are based on the analyses performed in Tamana et.al. For any given tool, the impact thresholds defined for the set of variants with the same effect on function as the variant examined, are preferred over those defined for the full dataset.
Sequence Viewer
Note: The NCBI Sequence Viewer is not installed on the ITHANET servers but it is embedded in this page from the NCBI.
Therefore, IthaGenes has no responsibility over any temporary unavailability of the service.
In such a case, please Refresh the page or retry at a later stage.
Otherwise, use this external link.
Publications / Origin
To the best of our knowledge, this is unpublished data. Please use with caution!
Microattributions
| A/A | Contributor(s) | Date | Comments |
|---|---|---|---|
| 1 | Syahzuwan, Hassan | 2023-05-25 | First report. |
Created on 2023-05-26 10:54:26,
Last reviewed on 2023-05-26 11:03:46 (Show full history)
| A/A | Date | Curator(s) | Comments |
|---|---|---|---|
| 1 | 2023-05-26 10:54:26 | The IthaGenes Curation Team | Created |
| 2 | 2023-05-26 10:56:04 | The IthaGenes Curation Team | Reviewed. Microattribution added |
| 3 | 2023-05-26 11:03:46 | The IthaGenes Curation Team | Reviewed. Hb name added |
Disclaimer: The information on this website is provided as an information resource only
and must not to be used as a substitute for professional diagnosis and treatment.
The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment,
diagnosis or any other information, services or products that an individual obtains through this website.
IthaGenes was last updated on 2024-11-20 13:24:07