IthaID: 4024



Names and Sequences

Functionality: Globin gene causative mutation Pathogenicity: N/A
Common Name: CD 15 (-GG, +C) HGVS Name: HBA2:c.46_47delinsC
Hb Name: N/A Protein Info: N/A

Context nucleotide sequence:
CAAGACCAACGTCAAGGCCGCCTGG [GG/C] TAAGGTCGGCGCGCACGCTGGCGA (Strand: +)

Also known as:

Comments: This is a frameshift variation that deletes two nucleotides (GG) from codon 15 in exon 1 of the HBA2 gene and inserts a C nucleotide. Results in a shortened α-globin chain with a stop codon at codon 48. Fοund together with heterozygous Hb Constant Spring [IthaID: 418] in a person of Malay origin: Hb 12 g/dL, MCV 67.1 fl, MCH 20.2 pg.

We follow the HGVS sequence variant nomenclature and IUPAC standards.

External Links

No available links

Phenotype

Hemoglobinopathy Group: Thalassaemia
Hemoglobinopathy Subgroup: α-thalassaemia
Allele Phenotype:N/A
Associated Phenotypes: N/A

Location

Chromosome: 16
Locus: NG_000006.1
Locus Location: 33821
Size: 2 bp
Located at: α2

Other details

Type of Mutation: Insertion & Deletion
Ethnic Origin: Malay
Molecular mechanism: N/A
Inheritance: Recessive
DNA Sequence Determined: Yes

In silico pathogenicity prediction

Sequence Viewer

Note: The NCBI Sequence Viewer is not installed on the ITHANET servers but it is embedded in this page from the NCBI. Therefore, IthaGenes has no responsibility over any temporary unavailability of the service. In such a case, please Refresh the page or retry at a later stage. Otherwise, use this external link.

Publications / Origin

To the best of our knowledge, this is unpublished data. Please use with caution!

Microattributions

A/AContributor(s)DateComments
1Abdul Hamid, Faidatul Syazlin2023-05-19First report.
Created on 2023-05-22 09:00:05, Last reviewed on (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.