IthaID: 40
Names and Sequences
| Functionality: | Globin gene causative mutation | Pathogenicity: | Pathogenic / Likely Pathogenic |
|---|---|---|---|
| Common Name: | CAP +41 to +44 (-AACA) | HGVS Name: | HBB:c.-10_-7delAACA |
| Hb Name: | N/A | Protein Info: | β nts 40 - 43 deleted |
Context nucleotide sequence:
CACAACTGTGTTCACTAGCAACCTCA [-/AACA] GACACCATGGTGCATCTGACTCCT (Strand: -)
Also known as: CAP +40 to +43 (-AAAC)
Comments: Found in a heterozygous state during molecular screening. In vitro experiments did not show functional effects of the genetic variant. Further investigation was suggested. Papers reported a 4 bp deletion -AAAC [HBB: c.-11_-8delAAAC], which does not follow the 3' prime rule of HGVS recommendations.
We follow the HGVS sequence variant nomenclature and IUPAC standards.
Phenotype
| Hemoglobinopathy Group: | Thalassaemia |
|---|---|
| Hemoglobinopathy Subgroup: | β-thalassaemia |
| Allele Phenotype: | β+ |
| Associated Phenotypes: | N/A |
Location
| Chromosome: | 11 |
|---|---|
| Locus: | NG_000007.3 |
| Locus Location: | 70585 |
| Size: | 4 bp |
| Located at: | β |
| Specific Location: | 5'UTR |
Other details
| Type of Mutation: | Point-Mutation(Deletion) |
|---|---|
| Effect on Gene/Protein Function: | 5'UTR (Transcription) |
| Ethnic Origin: | Chinese |
| Molecular mechanism: | N/A |
| Inheritance: | Recessive |
| DNA Sequence Determined: | No |
In silico pathogenicity prediction
Note:
The impact thresholds provided in this section are based on the analyses performed in Tamana et.al. For any given tool, the impact thresholds defined for the set of variants with the same effect on function as the variant examined, are preferred over those defined for the full dataset.
Sequence Viewer
Note: The NCBI Sequence Viewer is not installed on the ITHANET servers but it is embedded in this page from the NCBI.
Therefore, IthaGenes has no responsibility over any temporary unavailability of the service.
In such a case, please Refresh the page or retry at a later stage.
Otherwise, use this external link.
Publications / Origin
- Huang SZ, Xu YH, Zeng FY, Wu DF, Ren ZR, Zeng YT, A novel beta-thalassaemia mutation: deletion of 4 bp (-AAAC) in the 5' transcriptional sequence., British journal of haematology, 78(1), 125-6, 1991 PubMed
- Francès V, Morlé F, Godet J, Functional analysis of the 4 bp deletion identified in the 5' untranslated region of one of the beta-globin genes from a Chinese beta-thalassaemic heterozygote., Br. J. Haematol. , 84(1), 163-5, 1993 PubMed
Created on 2010-06-16 16:13:14,
Last reviewed on 2021-12-15 11:39:21 (Show full history)
| A/A | Date | Curator(s) | Comments |
|---|---|---|---|
| 1 | 2010-06-16 16:13:14 | The IthaGenes Curation Team | Created |
| 2 | 2013-10-15 17:28:32 | The IthaGenes Curation Team | Reviewed. |
| 3 | 2014-06-04 13:24:25 | The IthaGenes Curation Team | Reviewed. External links added. |
| 4 | 2019-11-04 11:52:34 | The IthaGenes Curation Team | Reviewed. Comment added. |
| 5 | 2019-11-04 11:53:33 | The IthaGenes Curation Team | Reviewed. |
| 6 | 2019-11-04 11:54:08 | The IthaGenes Curation Team | Reviewed. Clinical phenotype corrected. |
| 7 | 2019-11-06 13:09:06 | The IthaGenes Curation Team | Reviewed. Common name, HGVS name, Context sequence, Location and Comment corrected. sbSNP link removed. |
| 8 | 2020-11-10 13:13:22 | The IthaGenes Curation Team | Reviewed. HGVS name corrected. |
| 9 | 2020-11-10 13:15:24 | The IthaGenes Curation Team | Reviewed. Link added. |
| 10 | 2021-12-15 11:39:21 | The IthaGenes Curation Team | Reviewed. Other name added, Comment updated. |
Disclaimer: The information on this website is provided as an information resource only
and must not to be used as a substitute for professional diagnosis and treatment.
The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment,
diagnosis or any other information, services or products that an individual obtains through this website.
IthaGenes was last updated on 2024-04-18 10:10:45