IthaID: 3999



Names and Sequences

Functionality: Disease modifying mutation Pathogenicity: N/A
Common Name: rs9315599 HGVS Name: NC_000013.11:g.20463469C>G

Context nucleotide sequence:
CTCTAAAGGAAGCCAACCAGCATAA [C>G] AGTCCCAATGACTTCTGTCTCATGAG (Strand: +)

Also known as:

Comments: Associated with an increased risk of proteinuria in sickle cell disease cohorts (n 516 OMG-SCD, n 461 WalkPHaSST).

We follow the HGVS sequence variant nomenclature and IUPAC standards.

External Links

Phenotype

Allele Phenotype (Cis):N/A
Allele Phenotype (Trans):N/A
Associated Phenotypes: Proteinuria [HP:0000093]

Location

Chromosome: 13
Locus: N/A
Locus Location: N/A
Size: 1 bp
Located at: CRYL1
Specific Location: Intron 3

Other details

Type of Mutation: Point-Mutation(Substitution)
Effect on Gene/Protein Function: N/A
Ethnic Origin: N/A
Molecular mechanism: N/A
Inheritance: Quantitative trait
DNA Sequence Determined: Yes

In silico pathogenicity prediction

Sequence Viewer

Note: The NCBI Sequence Viewer is not installed on the ITHANET servers but it is embedded in this page from the NCBI. Therefore, IthaGenes has no responsibility over any temporary unavailability of the service. In such a case, please Refresh the page or retry at a later stage. Otherwise, use this external link.

Publications / Origin

  1. Garrett ME, Soldano KL, Erwin KN, Zhang Y, Gordeuk VR, Gladwin MT, Telen MJ, Ashley-Koch AE, Genome-wide meta-analysis identifies new candidate genes for sickle cell disease nephropathy., Blood Adv, 2022 PubMed
Created on 2023-01-17 14:52:11, Last reviewed on 2023-01-17 14:53:23 (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.