IthaID: 3965

Names and Sequences

Functionality:	Globin gene causative mutation	Pathogenicity:	N/A
Common Name:	CD 84-87 (-CTTTGCCACA) (+TTTTTCTCAG)	HGVS Name:	HBB:c.255_264delinsTTTTTCTCAG
Hb Name:	Hb Wanjiang	Protein Info:	N/A

Context nucleotide sequence:
CCTGGACAACCTCAAGGGCAC [CTTTGCCACA/TTTTTCTCAG] CTGAGTGAGCTGCACTGTGAC (Strand: -)

Also known as: Hb Donguan-Dongcheng

Comments: Found in a male and his father presented with normal hematological features. The variant results from a 10 bp deletion at codons 84-87 of the β-globin chain, replaced with 10 nucleotides coming from the δ-globin gene at the same position, leading to the substitution of two amino acids in the peptide chain with no change in the β-globin chain length. The abnormal Hb variant was not detectable by CE and HPLC. Found in 8 healthy individuals from southern China during premarital/antenatal screening.

We follow the HGVS sequence variant nomenclature and IUPAC standards.

External Links

No available links

Phenotype

Hemoglobinopathy Group:	Structural Haemoglobinopathy
Hemoglobinopathy Subgroup:	β-chain variant
Allele Phenotype:	N/A
Stability:	N/A
Oxygen Affinity:	N/A
Associated Phenotypes:	N/A

IthaPhen

Heterozygous records (preview in IthaPhen)

Location

Chromosome:	11
Locus:	NG_000007.3
Locus Location:	70979
Size:	10 bp
Located at:	β
Specific Location:	Exon 2

Other details

Type of Mutation:	Point-Mutation(Deletion)
Effect on Gene/Protein Function:	Missense codons (Protein Structure)
Ethnic Origin:	Chinese
Molecular mechanism:	N/A
Inheritance:	Recessive
DNA Sequence Determined:	Yes

In silico pathogenicity prediction

Sequence Viewer

Note: The NCBI Sequence Viewer is not installed on the ITHANET servers but it is embedded in this page from the NCBI. Therefore, IthaGenes has no responsibility over any temporary unavailability of the service. In such a case, please Refresh the page or retry at a later stage. Otherwise, use this external link.

Publications / Origin

Wu SM, Jiang F, Li C, Guo ZT, Huang SR, Li DZ, Hb Wanjiang: A New β-Globin Chain Variant with Two Amino Acid Substitutions (: c.255_264delinsTTTTTCTCAG)., Hemoglobin, 2022 PubMed
Zhang Q, Wang G, Sun D, Lin W, Yan T, Wu Y, Wu M, Chen J, Zou S, Xie W, Zhou Y, Wang Y, He L, Liu Y, Qiu Z, Hu L, Lin B, Zhou X, Li Y, Xu X, MALDI-TOF-MS for Rapid Screening and Typing of β-Globin Variant and β-Thalassemia through Direct Measurements of Intact Globin Chains., Clin Chem, 2022 PubMed

Created on 2022-09-07 08:44:28, Last reviewed on 2022-12-06 12:54:41 (Show full history)

A/A	Date	Curator(s)	Comments
1	2022-09-07 08:44:28	The IthaGenes Curation Team	Created
2	2022-12-06 12:54:41	The IthaGenes Curation Team	Reviewed. Reference and Synonym name added. Comment edits.

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.