IthaID: 3921
Names and Sequences
Functionality: | Disease modifying mutation | Pathogenicity: | N/A |
---|---|---|---|
Common Name: | rs964184 | HGVS Name: | NC_000011.10:g.116778201G>C |
Context nucleotide sequence:
TAATCACCATCTGATGTACTGTTTTCCT [G>C] ATCTGTTTATTGTCATTTTTCCCCACTAG (Strand: +)
Also known as:
Comments: The G allele associated with increased levels of triglycerides (TG) in children over 10 years old and the atherogenic ratio TG/HDL-C in a cohort of SCD.
External Links
Phenotype
Allele Phenotype (Cis): | N/A |
---|---|
Allele Phenotype (Trans): | N/A |
Associated Phenotypes: | N/A |
Location
Chromosome: | 11 |
---|---|
Locus: | NM_003904.5 |
Locus Location: | N/A |
Size: | 1 bp |
Located at: | ZPR1 |
Specific Location: | 3'UTR |
Other details
Type of Mutation: | Point-Mutation(Substitution) |
---|---|
Effect on Gene/Protein Function: | N/A |
Ethnic Origin: | Brazilian |
Molecular mechanism: | N/A |
Inheritance: | Quantitative trait |
DNA Sequence Determined: | Yes |
Sequence Viewer
Note: The NCBI Sequence Viewer is not installed on the ITHANET servers but it is embedded in this page from the NCBI.
Therefore, IthaGenes has no responsibility over any temporary unavailability of the service.
In such a case, please Refresh the page or retry at a later stage.
Otherwise, use this external link.
Publications / Origin
- Valente-Frossard TNS, Cruz NRC, Ferreira FO, Belisario AR, Pereira BM, Gomides AFF, Resende GAD, Carlos AM, Moraes-Souza H, Velloso-Rodrigues C, Polymorphisms in genes that affect the variation of lipid levels in a Brazilian pediatric population with sickle cell disease: rs662799 APOA5 and rs964184 ZPR1., Blood Cells Mol Dis, 80(0), 102376, 2020 PubMed
Created on 2022-05-09 17:37:52,
Last reviewed on (Show full history)
A/A | Date | Curator(s) | Comments |
---|---|---|---|
1 | 2022-05-09 17:37:52 | The IthaGenes Curation Team | Created |
Disclaimer: The information on this website is provided as an information resource only
and must not to be used as a substitute for professional diagnosis and treatment.
The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment,
diagnosis or any other information, services or products that an individual obtains through this website.
IthaGenes was last updated on 2022-06-24 13:54:27