IthaID: 3920



Names and Sequences

Functionality: Globin gene causative mutation Pathogenicity: N/A
Common Name: -368 C>A HGVS Name: HBG1:c.-420C>A
Hb Name: N/A Protein Info: N/A
Also known as:

We follow the HGVS sequence variant nomenclature and IUPAC standards.

Context nucleotide sequence:
TTAAACTACAGGCCTCACTGGAG [C/A] TAGAGACAAGAAGGTAAAAAACG (Strand: -)

Comments: Found in a case in association with HBG1:c.-272_-275dup [IthaID:3865], presented with Hb 15.6 g/dL, MCV 85.2 fL and MCH 28.1 pg. Haemoglobin electrophoresis shown HbA 85.4%, HbA2 2.5% and HbF 11.6% and a small abnormal peak of 0.5% appears next to Hb A2.

External Links

Phenotype

Hemoglobinopathy Group: HPFH
Hemoglobinopathy Subgroup: HPFH
Allele Phenotype:N/A
Associated Phenotypes: Hb F levels [HP:0011904] [OMIM:141749]

Location

Chromosome: 11
Locus: NG_000007.3
Locus Location: 47391
Size: 1 bp
Located at:
Specific Location: Promoter

Other details

Type of Mutation: Point-Mutation(Substitution)
Effect on Gene/Protein Function: Promoter (Transcription)
Ethnic Origin: Han Chinese
Molecular mechanism: N/A
Inheritance: Recessive
DNA Sequence Determined: Yes

In silico pathogenicity prediction

Sequence Viewer

Note: The NCBI Sequence Viewer is not installed on the ITHANET servers but it is embedded in this page from the NCBI. Therefore, IthaGenes has no responsibility over any temporary unavailability of the service. In such a case, please Refresh the page or retry at a later stage. Otherwise, use this external link.

Publications / Origin

To the best of our knowledge, this is unpublished data. Please use with caution!

Microattributions

A/AContributor(s)DateComments
1Zhuang, Qianmei 2022-05-06First report.
Created on 2022-05-09 13:06:24, Last reviewed on (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.