IthaID: 392



Names and Sequences

Functionality: Globin gene causative mutation Pathogenicity: Pathogenic / Likely Pathogenic
Common Name: IVS II-142 G>A HGVS Name: HBA2:c.301-1G>A
Hb Name: N/A Protein Info: N/A
Also known as:

We follow the HGVS sequence variant nomenclature and IUPAC standards.

Context nucleotide sequence:
CCCCACTGACCCTCTTCTCTGCACA [G>A] CTCCTAAGCCACTGCCTGCTGGTGACCCTG (Strand: +)

Comments: Mutation involves the splice acceptor site (AG>AA) and thus affects RNA processing, leading to a complete suppression of the alpha-globin chain production. Patient presents with Hb H disease.

External Links

Phenotype

Hemoglobinopathy Group: Thalassaemia
Hemoglobinopathy Subgroup: α-thalassaemia
Allele Phenotype:α⁺
Associated Phenotypes: N/A

Location

Chromosome: 16
Locus: NG_000006.1
Locus Location: 34334
Size: 1 bp
Located at: α2
Specific Location: Intron 2

Other details

Type of Mutation: Point-Mutation(Substitution)
Effect on Gene/Protein Function: Consensus splice site (mRNA Processing)
Ethnic Origin: Arab/Italian
Molecular mechanism: N/A
Inheritance: Recessive
DNA Sequence Determined: Yes

In silico pathogenicity prediction

Sequence Viewer

Note: The NCBI Sequence Viewer is not installed on the ITHANET servers but it is embedded in this page from the NCBI. Therefore, IthaGenes has no responsibility over any temporary unavailability of the service. In such a case, please Refresh the page or retry at a later stage. Otherwise, use this external link.

Frequencies

Publications / Origin

  1. Noguera NI, González FA, Dávoli RA, Milani AC, Villegas A, A novel splice acceptor site mutation of the alpha2-globin gene causing alpha-thalassemia., Hemoglobin, 25(3), 311-5, 2001 PubMed
Created on 2010-06-16 16:13:15, Last reviewed on 2016-09-06 11:53:37 (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.