IthaID: 3910



Names and Sequences

Functionality: Disease modifying mutation Pathogenicity: N/A
Common Name: rs2250806 HGVS Name: NC_000001.11:g.84130407A>G

Context nucleotide sequence:
AACAAGTACCTCAAATTATGAGAAAGA [A>G ] TGGAGACAACCCAGAAAAGAGTCAGT (Strand: +)

Also known as:

Comments: Associated with silent cerebral infarction in patients with sickle cell disease from the South East London sickle gene bank (London, UK).

External Links

Phenotype

Allele Phenotype (Cis):N/A
Allele Phenotype (Trans):N/A
Associated Phenotypes: Stroke [HP:0001297] [OMIM:601367]

Location

Chromosome: 1
Locus: NG_029728.1
Locus Location: N/A
Size: 1 bp
Located at: PRKACB
Specific Location: Intron 1

Other details

Type of Mutation: Point-Mutation(Substitution)
Effect on Gene/Protein Function: N/A
Ethnic Origin: N/A
Molecular mechanism: N/A
Inheritance: Quantitative trait
DNA Sequence Determined: Yes

Sequence Viewer

Note: The NCBI Sequence Viewer is not installed on the ITHANET servers but it is embedded in this page from the NCBI. Therefore, IthaGenes has no responsibility over any temporary unavailability of the service. In such a case, please Refresh the page or retry at a later stage. Otherwise, use this external link.

Publications / Origin

  1. Brewin JN, Rooks H, Gardner K, Senior H, Morje M, Patel H, Calvet D, Bartolucci P, Thein SL, Menzel S, Rees DC, Genome wide association study of silent cerebral infarction in sickle cell disease (HbSS and HbSC)., Haematologica, 106(6), 1770-1773, 2021 PubMed
Created on 2022-03-29 13:40:33, Last reviewed on (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.