IthaID: 3883



Names and Sequences

Functionality: Globin gene causative mutation Pathogenicity: N/A
Common Name: IVS I-1 G>C HGVS Name: HBD:c.92+1G>C
Hb Name: N/A Protein Info: N/A

Context nucleotide sequence:
AGTTGGTGGTGAGGCCCTGGGCAG [G>C] TTGGTATCAAGGTTATAAGAGAGG (Strand: -)

Also known as:

Comments: Found in a heterozygous state. This mutation likely activates a cryptic acceptor site (actttttctcagCT) at exon 2 (c.253) with a HSF score of 87.41. In this case, the reported mutation would produce an abnormal mRNA resulting in reduced HbA2 level. There may be some possibility that in IVS Ӏ-1 G>C, exon 1 joins directly to exon 3 by removing IVS Ӏ, exon 2, and IVS ӀӀ by splicing.

We follow the HGVS sequence variant nomenclature and IUPAC standards.

External Links

No available links

Phenotype

Hemoglobinopathy Group: Thalassaemia
Hemoglobinopathy Subgroup: δ-thalassaemia
Allele Phenotype:N/A
Associated Phenotypes: N/A

Location

Chromosome: 11
Locus: NG_000007.3
Locus Location: 63275
Size: 1 bp
Located at: δ
Specific Location: Intron 1

Other details

Type of Mutation: Point-Mutation(Substitution)
Effect on Gene/Protein Function: Splice junction (mRNA Processing)
Ethnic Origin: Tunisian
Molecular mechanism: N/A
Inheritance: Recessive
DNA Sequence Determined: Yes

In silico pathogenicity prediction

Sequence Viewer

Note: The NCBI Sequence Viewer is not installed on the ITHANET servers but it is embedded in this page from the NCBI. Therefore, IthaGenes has no responsibility over any temporary unavailability of the service. In such a case, please Refresh the page or retry at a later stage. Otherwise, use this external link.

Publications / Origin

  1. Kasmi C, Amri Y, Hadj-Fredj S, Oueslati S, Dabboussi M, Mahjoub R, Hammami S, Aljane I, Mami FB, Jamoussi H, Messaoud T, Bibi A, Analysis of δ-globin gene alleles in Tunisians: description of three new delta-thalassemia mutations., Mol Biol Rep, 48(8), 5923-5933, 2021 PubMed
Created on 2021-12-29 15:38:15, Last reviewed on (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.