IthaID: 3866



Names and Sequences

Functionality: Globin gene causative mutation Pathogenicity: N/A
Common Name: IVS II-659_664 (-GCAATA) HGVS Name: HBB:c.316-192_187del
Hb Name: N/A Protein Info: N/A

Context nucleotide sequence:
TTTCTGGGTTAAGGCAATA [GCAATA /-] TCTCTGCATATAAATATTTC (Strand: -)

Also known as:

Comments: Found in a 60-year-old female in compound heterozygosity with Hb G-Taipei [IthaID:877] with no clinical presentation. Capillary electrophoresis shown HbA 56.4%, HbF 0%, HbA2 3.0%, and Hb G-Taipei 40.6%.

External Links

No available links

Phenotype

Hemoglobinopathy Group: Thalassaemia
Hemoglobinopathy Subgroup: β-thalassaemia
Allele Phenotype:N/A
Associated Phenotypes: N/A

Location

Chromosome: 11
Locus: NG_000007.3
Locus Location: 71698
Size: 6 bp
Located at: β
Specific Location: Intron 2

Other details

Type of Mutation: Point-Mutation(Deletion)
Effect on Gene/Protein Function: Cryptic splice site (mRNA Processing)
Ethnic Origin: Chinese
Molecular mechanism: N/A
Inheritance: Recessive
DNA Sequence Determined: Yes

Sequence Viewer

Note: The NCBI Sequence Viewer is not installed on the ITHANET servers but it is embedded in this page from the NCBI. Therefore, IthaGenes has no responsibility over any temporary unavailability of the service. In such a case, please Refresh the page or retry at a later stage. Otherwise, use this external link.

Publications / Origin

To the best of our knowledge, this is unpublished data. Please use with caution!

Microattributions

A/AContributor(s)DateComments
1Li, Youqiong2021-09-29First report.
Created on 2021-09-30 12:11:48, Last reviewed on (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.