IthaID: 3818



Names and Sequences

Functionality: Disease modifying mutation Pathogenicity: N/A
Common Name: rs10160820 HGVS Name: NG_000007.3:g.36389T>G

Context nucleotide sequence:
GATCATTCAGGAGCAGGTTATTTAAT [T>G] TCCCTGTATTTGCATGGTTTTGAAGGT (Strand: -)

Also known as:

Comments: Associated with disease severity in Thai individuals with β0-thalassaemia/HbE.

We follow the HGVS sequence variant nomenclature and IUPAC standards.

External Links

Phenotype

Allele Phenotype (Cis):N/A
Allele Phenotype (Trans):N/A
Associated Phenotypes: Severity [HP:0012824]

Location

Chromosome: 11
Locus: NG_000007.3
Locus Location: 36389
Size: 1 bp
Located at: HBG2-HBE1
Specific Location: N/A

Other details

Type of Mutation: Point-Mutation(Substitution)
Effect on Gene/Protein Function: N/A
Ethnic Origin: Thai
Molecular mechanism: N/A
Inheritance: Quantitative trait
DNA Sequence Determined: Yes

In silico pathogenicity prediction

Sequence Viewer

Note: The NCBI Sequence Viewer is not installed on the ITHANET servers but it is embedded in this page from the NCBI. Therefore, IthaGenes has no responsibility over any temporary unavailability of the service. In such a case, please Refresh the page or retry at a later stage. Otherwise, use this external link.

Publications / Origin

  1. Sherva R, Sripichai O, Abel K, Ma Q, Whitacre J, Angkachatchai V, Makarasara W, Winichagoon P, Svasti S, Fucharoen S, Braun A, Farrer LA, Genetic modifiers of Hb E/beta0 thalassemia identified by a two-stage genome-wide association study., BMC Med. Genet. , 11(0), 51, 2010 PubMed
Created on 2021-07-12 15:01:28, Last reviewed on (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.