IthaID: 3817
Names and Sequences
| Functionality: | Globin gene causative mutation | Pathogenicity: | N/A |
|---|---|---|---|
| Common Name: | CD 4 (-T) | HGVS Name: | HBB:c.14delC |
| Hb Name: | N/A | Protein Info: | N/A |
Context nucleotide sequence:
ACAGACACCATGGTGCATCTGA [C/-] TCCTGAGGAGAAGTCTGCCGTT (Strand: -)
Protein sequence:
MVHLILRRSLPLLPCGAGX
Also known as:
Comments: Found in a 31-year old male and his mother presented with decreased levels of MCV, MCH and increased level of HbA2.Τhe C deletion, causing a frameshift that introduces a premature stop codon fourteen amino acids further down the new reading frame.
We follow the HGVS sequence variant nomenclature and IUPAC standards.
External Links
No available links
Phenotype
| Hemoglobinopathy Group: | Thalassaemia |
|---|---|
| Hemoglobinopathy Subgroup: | β-thalassaemia |
| Allele Phenotype: | N/A |
| Associated Phenotypes: | N/A |
Location
| Chromosome: | 11 |
|---|---|
| Locus: | NG_000007.3 |
| Locus Location: | 70608 |
| Size: | 1 bp |
| Located at: | β |
| Specific Location: | Exon 1 |
Other details
| Type of Mutation: | Point-Mutation(Deletion) |
|---|---|
| Effect on Gene/Protein Function: | Frameshift (Translation) |
| Ethnic Origin: | Chinese |
| Molecular mechanism: | N/A |
| Inheritance: | Recessive |
| DNA Sequence Determined: | Yes |
In silico pathogenicity prediction
Note:
The impact thresholds provided in this section are based on the analyses performed in Tamana et.al. For any given tool, the impact thresholds defined for the set of variants with the same effect on function as the variant examined, are preferred over those defined for the full dataset.
Sequence Viewer
Note: The NCBI Sequence Viewer is not installed on the ITHANET servers but it is embedded in this page from the NCBI.
Therefore, IthaGenes has no responsibility over any temporary unavailability of the service.
In such a case, please Refresh the page or retry at a later stage.
Otherwise, use this external link.
Publications / Origin
- Chen J, Lin S, Gan J, Xin X, Huang J, A novel β-thalassemia variant at HBB:c.14delC (Codon 4, -C) identified via next-generation sequencing., Hematology, 25(1), 400-404, 2020 PubMed
Created on 2021-07-12 13:01:52,
Last reviewed on 2021-07-12 13:03:00 (Show full history)
| A/A | Date | Curator(s) | Comments |
|---|---|---|---|
| 1 | 2021-07-12 13:01:52 | The IthaGenes Curation Team | Created |
| 2 | 2021-07-12 13:03:00 | The IthaGenes Curation Team | Reviewed. Protein info added. |
Disclaimer: The information on this website is provided as an information resource only
and must not to be used as a substitute for professional diagnosis and treatment.
The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment,
diagnosis or any other information, services or products that an individual obtains through this website.
IthaGenes was last updated on 2024-11-20 13:24:07