IthaID: 381



Names and Sequences

Functionality: Globin gene causative mutation Pathogenicity: Pathogenic / Likely Pathogenic
Common Name: CD 62 (-GTG) [-Val] HGVS Name: HBA1:c.187_189del
Hb Name: Hb Aghia Sophia Protein Info: α1 62(E11) Val->0

Context nucleotide sequence:
CCAGGTTAAGGGCCACGGCAAGAAG [GTG/-] GCCGACGCGCTGACCAACGCCGTGG (Strand: +)

Also known as:

Comments: The 3bp deletion is virtually silent in the heterozygote carrier and is revealed only by the interaction with an α0-thalassaemia haplotype.

We follow the HGVS sequence variant nomenclature and IUPAC standards.

Phenotype

Hemoglobinopathy Group: Thalassaemia and Structural Haemoglobinopathy
Hemoglobinopathy Subgroup: α-thalassaemia, α-chain variant
Allele Phenotype:α⁺
Stability: N/A
Oxygen Affinity: N/A
Associated Phenotypes: Haemolytic anaemia [HP:0001878]

Location

Chromosome: 16
Locus: NG_000006.1
Locus Location: 37883
Size: 3 bp
Located at: α1
Specific Location: Exon 2

Other details

Type of Mutation: Point-Mutation(Deletion)
Effect on Gene/Protein Function: Insertion/Deletion of codons (Protein Structure)
Ethnic Origin: Greek
Molecular mechanism: N/A
Inheritance: Recessive
DNA Sequence Determined: Yes

In silico pathogenicity prediction

Sequence Viewer

Note: The NCBI Sequence Viewer is not installed on the ITHANET servers but it is embedded in this page from the NCBI. Therefore, IthaGenes has no responsibility over any temporary unavailability of the service. In such a case, please Refresh the page or retry at a later stage. Otherwise, use this external link.

Publications / Origin

  1. Traeger-Synodinos J, Harteveld CL, Kanavakis E, Giordano PC, Kattamis C, Bernini LF, Hb Aghia Sophia [alpha62(E11)Val-->0 (alpha1)], an , Hemoglobin , 23(4), 317-24, 1999 PubMed
Created on 2010-06-16 16:13:15, Last reviewed on 2022-02-28 08:16:08 (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.