IthaID: 3764



Names and Sequences

Functionality: Globin gene causative mutation Pathogenicity: N/A
Common Name: -4 G>C HGVS Name: HBA2:c.-41C>G
Hb Name: N/A Protein Info: N/A

Context nucleotide sequence:
GCATAAACCCTGGCGCGCTCGCGGGC [C/G] GGCACTCTTCTGGTCCCCACAGACTCA (Strand: +)

Also known as:

Comments: Found in three unrelated cases (Malay and Indian) presented clinically normal with mild low MCV and MCH and normal HbA2 level. GAP-PCR showed presence of two abnormal bands around 3.7 gene deletion in 2 cases. Recently, the substitution reported in a 17-year old male with Hb 14.4 g/dL, MCV 77.2 fL, MCH 24.2 pg, RBC 5.96 10^12/L and RDW 13.2 % with normal HbA2 value. GAP-PCR showed presence of two abnormal bands around 3.7 gene deletion. Molecular analysis showed the substitution C>G at both HbA1 and HbA2 regions.

External Links

Phenotype

Hemoglobinopathy Group: Thalassaemia
Hemoglobinopathy Subgroup: α-thalassaemia
Allele Phenotype:Unclear
Associated Phenotypes: N/A

Location

Chromosome: 16
Locus: NG_000006.1
Locus Location: 33735
Size: 1 bp
Located at: α2
Specific Location: Promoter

Other details

Type of Mutation: Point-Mutation(Substitution)
Effect on Gene/Protein Function: Promoter (Transcription)
Ethnic Origin: Malay, Indian
Molecular mechanism: N/A
Inheritance: Recessive
DNA Sequence Determined: Yes

Sequence Viewer

Note: The NCBI Sequence Viewer is not installed on the ITHANET servers but it is embedded in this page from the NCBI. Therefore, IthaGenes has no responsibility over any temporary unavailability of the service. In such a case, please Refresh the page or retry at a later stage. Otherwise, use this external link.

Publications / Origin

To the best of our knowledge, this is unpublished data. Please use with caution!

Microattributions

A/AContributor(s)DateComments
1Mohd Yasin, Norafiza 2020-11-24First report.
Created on 2021-04-01 00:14:14, Last reviewed on 2021-04-01 00:15:30 (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.