IthaID: 3746



Names and Sequences

Functionality: Disease modifying mutation Pathogenicity: N/A
Common Name: rs7122044 HGVS Name: NC_000011.10:g.72751589A>G

Context nucleotide sequence:
AGTCAAATCCTTCCGAGTACCCCCAGGT [A>G] TCTGGCCCTGAAGCACCCCCCTCCCAC (Strand: +)

Also known as:

Comments: Allele 'A' associated with alloimmune responder status in an African American cohort of multiply transfused sickle cell disease patients.

External Links

Phenotype

Allele Phenotype (Cis):N/A
Allele Phenotype (Trans):N/A
Associated Phenotypes: Red blood cell alloimmunisation

Location

Chromosome: 11
Locus: NM_001040118.3
Locus Location: N/A
Size: 1 bp
Located at: ARAP1
Specific Location: Intron 1

Other details

Type of Mutation: Point-Mutation(Substitution)
Effect on Gene/Protein Function: N/A
Ethnic Origin: African American
Molecular mechanism: N/A
Inheritance: Quantitative trait
DNA Sequence Determined: Yes

Sequence Viewer

Note: The NCBI Sequence Viewer is not installed on the ITHANET servers but it is embedded in this page from the NCBI. Therefore, IthaGenes has no responsibility over any temporary unavailability of the service. In such a case, please Refresh the page or retry at a later stage. Otherwise, use this external link.

Publications / Origin

  1. Hanchard NA, Moulds JM, Belmont JW, Chen A, A Genome-Wide Screen for Large-Effect Alloimmunization Susceptibility Loci among Red Blood Cell Transfusion Recipients with Sickle Cell Disease., Transfus Med Hemother, 41(6), 453-61, 2014 PubMed
Created on 2021-02-17 18:00:58, Last reviewed on (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.