IthaID: 3745

Names and Sequences

Functionality:	Globin gene causative mutation	Pathogenicity:	Pathogenic / Likely Pathogenic
Common Name:	IVS I-1 G>A	HGVS Name:	HBA2:c.95+1G>A
Hb Name:	N/A	Protein Info:	N/A

Context nucleotide sequence:
GAGTATGGTGCGGAGGCCCTGGAGAG [G/A] TGAGGCTCCCTCCCCTGCTCCGACCCG (Strand: +)

Also known as:

Comments: Found in patients with microcytosis and hypochromia. In the presence of the G>A mutation, a cryptic splice site 49 bp upstream of the exon1/intron 1 boundary is activated and a premature stop codon is introduced between codons 48 and 49 in exon 2. As this premature stop codon is located 152 nts upstream of the last exon-exon junction, the mature mRNA may be degraded by the nonsense mediated decay mechanism or further processed to produce a truncated nonfunctional protein.

We follow the HGVS sequence variant nomenclature and IUPAC standards.

External Links

ClinVar

Phenotype

Hemoglobinopathy Group:	Thalassaemia
Hemoglobinopathy Subgroup:	α-thalassaemia
Allele Phenotype:	α⁺
Associated Phenotypes:	N/A

IthaPhen

Heterozygous records (preview in IthaPhen)

Location

Chromosome:	16
Locus:	NG_000006.1
Locus Location:	33871
Size:	1 bp
Located at:	α2
Specific Location:	Intron 1

Other details

Type of Mutation:	Point-Mutation(Substitution)
Effect on Gene/Protein Function:	Cryptic splice site (mRNA Processing), Frameshift (Translation)
Ethnic Origin:	Canadian, Italian
Molecular mechanism:	N/A
Inheritance:	Recessive
DNA Sequence Determined:	Yes

In silico pathogenicity prediction

Sequence Viewer

Note: The NCBI Sequence Viewer is not installed on the ITHANET servers but it is embedded in this page from the NCBI. Therefore, IthaGenes has no responsibility over any temporary unavailability of the service. In such a case, please Refresh the page or retry at a later stage. Otherwise, use this external link.

Publications / Origin

Waye JS, Eng B, Dutly F, Frischknecht H, alpha-Thalassemia caused by two novel splice mutations of the alpha2-globin gene: IVS-I-1 (G>A and G>T)., Hemoglobin, 33(6), 519-22, 2009 PubMed
Qadah T, Finlayson J, Ghassemifar R, In vitro characterization of the α-thalassemia point mutation HBA2:c.95+1G>A [IVS-I-1(G>A) (α2)]., Hemoglobin, 36(1), 38-46, 2012 PubMed

Created on 2021-02-17 16:56:30, Last reviewed on 2022-07-12 11:40:09 (Show full history)

A/A	Date	Curator(s)	Comments
1	2021-02-17 16:56:30	The IthaGenes Curation Team	Created
2	2021-02-17 16:58:03	The IthaGenes Curation Team	Reviewed. Common name added.
3	2022-07-12 11:40:09	The IthaGenes Curation Team	Reviewed. Allele phenotype added.

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.