IthaID: 3731
Names and Sequences
Functionality: | Globin gene causative mutation | Pathogenicity: | Variant of Uncertain Significance |
---|---|---|---|
Common Name: | IVS II-34 G>A | HGVS Name: | HBA2:c.300+34G>A |
Hb Name: | N/A | Protein Info: | N/A |
Also known as: |
We follow the
HGVS sequence variant nomenclature
and
IUPAC standards.
Context nucleotide sequence:
GGCCGGGAGCGATCTGGGTCGAG [G/A] GGCGAGATGGCGCCTTCCTCTCAG (Strand: +)
Comments: Reported in five unrelated cases. In 1st case, the IVS II-34 G>A found in compound heterozygosity (cis/trans) with Hb Georgia [IthaID: 3718], in a 17-year old individual presented with reduced level of Hb 11 g/dL, MCV 74 fL and MCH 23.7 pg, normal HbA2 2.4 % but elevated level of HbF 10.6 %. The remaining four cases were asymptomatic with Hb range 9.5-13.3 g/dL, MCV 55.9-87.4 fL, MCH 18.1-29.5 pg, RBC 4.5-7 10^12/L and HbA2 1.6-3.2 %, without abnormal peak. One of these cases has co-inheritance with underlying iron deficiency anemia presented with reduced level of Hb 9.5 g/dL, MCV 18.1 fL, MCV 62 pg and HbA2 1.6 %.
External Links
Phenotype
Hemoglobinopathy Group: | Thalassaemia |
---|---|
Hemoglobinopathy Subgroup: | α-thalassaemia |
Allele Phenotype: | N/A |
Associated Phenotypes: | N/A |
Location
Chromosome: | 16 |
---|---|
Locus: | NG_000006.1 |
Locus Location: | 34226 |
Size: | 1 bp |
Located at: | α2 |
Specific Location: | Intron 2 |
Other details
Type of Mutation: | Point-Mutation(Substitution) |
---|---|
Effect on Gene/Protein Function: | N/A |
Ethnic Origin: | Malay |
Molecular mechanism: | N/A |
Inheritance: | Recessive |
DNA Sequence Determined: | Yes |
In silico pathogenicity prediction
Sequence Viewer
Publications / Origin
To the best of our knowledge, this is unpublished data. Please use with caution!
Microattributions
A/A | Contributor(s) | Date | Comments |
---|---|---|---|
1 | Mohd Yasin, Norafiza | 2020-11-24 | First report. |