IthaID: 3731

Names and Sequences

Functionality:	Globin gene causative mutation	Pathogenicity:	Variant of Uncertain Significance
Common Name:	IVS II-34 G>A	HGVS Name:	HBA2:c.300+34G>A
Hb Name:	N/A	Protein Info:	N/A

Context nucleotide sequence:
GGCCGGGAGCGATCTGGGTCGAG [G/A] GGCGAGATGGCGCCTTCCTCTCAG (Strand: +)

Also known as:

Comments: Reported in five unrelated cases. In 1st case, the IVS II-34 G>A found in compound heterozygosity (cis/trans) with Hb Georgia [IthaID: 3718], in a 17-year old individual presented with reduced level of Hb 11 g/dL, MCV 74 fL and MCH 23.7 pg, normal HbA2 2.4 % but elevated level of HbF 10.6 %. The remaining four cases were asymptomatic with Hb range 9.5-13.3 g/dL, MCV 55.9-87.4 fL, MCH 18.1-29.5 pg, RBC 4.5-7 10^12/L and HbA2 1.6-3.2 %, without abnormal peak. One of these cases has co-inheritance with underlying iron deficiency anemia presented with reduced level of Hb 9.5 g/dL, MCV 18.1 fL, MCV 62 pg and HbA2 1.6 %.

We follow the HGVS sequence variant nomenclature and IUPAC standards.

External Links

dbSNP

Phenotype

Hemoglobinopathy Group:	Thalassaemia
Hemoglobinopathy Subgroup:	α-thalassaemia
Allele Phenotype:	N/A
Associated Phenotypes:	N/A

IthaPhen

Heterozygous records (preview in IthaPhen)

Location

Chromosome:	16
Locus:	NG_000006.1
Locus Location:	34226
Size:	1 bp
Located at:	α2
Specific Location:	Intron 2

Other details

Type of Mutation:	Point-Mutation(Substitution)
Effect on Gene/Protein Function:	N/A
Ethnic Origin:	Malay
Molecular mechanism:	N/A
Inheritance:	Recessive
DNA Sequence Determined:	Yes

In silico pathogenicity prediction

Sequence Viewer

Note: The NCBI Sequence Viewer is not installed on the ITHANET servers but it is embedded in this page from the NCBI. Therefore, IthaGenes has no responsibility over any temporary unavailability of the service. In such a case, please Refresh the page or retry at a later stage. Otherwise, use this external link.

Publications / Origin

To the best of our knowledge, this is unpublished data. Please use with caution!

Microattributions

A/A	Contributor(s)	Date	Comments
1	Mohd Yasin, Norafiza	2020-11-24	First report.

Created on 2021-02-10 07:51:48, Last reviewed on 2021-05-14 15:42:33 (Show full history)

A/A	Date	Curator(s)	Comments
1	2021-02-10 07:51:48	The IthaGenes Curation Team	Created
2	2021-05-14 15:42:33	The IthaGenes Curation Team	Reviewed.

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.