IthaID: 3729



Names and Sequences

Functionality: Globin gene causative mutation Pathogenicity: N/A
Common Name: IVS I-11 (-24bp) HGVS Name: HBA2:c.95+11_95+34del
Hb Name: N/A Protein Info: N/A

Context nucleotide sequence:
GTGAGGCTCC [CTCCCCTGCTCCGACCCGGGCTCC/-] TCGCCCGCCC (Strand: +)

Also known as:

Comments: Found in six cases. In 1st case, the IVS I-11 (-24bp) reported in compound heterozygosity the with –FIL deletion [IthaID: 311], in a 23-year old Kadazan-Dusun individual presented with reduced level of Hb 8.8 g/dL, MCV 68.6 fL, MCH 21.3 pg and RBC 4.13 10^12/L, without hepatosplenomegaly and transfusion history. HPLC analysis shown elevated level of HbA2 6 % and HbF 3.7 %, whereas a small peak 15 at zone 11 found with CE. In 2nd case, the IVS I-11 (-24bp) reported in compound heterozygosity with IVS I-5. The individual presented with decreased level of Hb 11.7 g/dL, MCV 63.3 fL, MCH 19.1 pg and RBC 6.11 10^12/L and elevated level of HbA2 4.5 % and HbF 4.8 %. The rest 4 cases are related cases from the same family. The IVS I-11 (-24bp) found in a 29-year old Sabah/Rungus ethnicity female and her 52-year old father in compound heterozygosity with the Hb A2-Deventer [IthaID: 2573]. The daughter presented with normal level of Hb 13.6 g/dL, MCV 81.4 fL, MCH 26.6 pg, RBC 5.12 10^12/L, HbF and HbA and reduced level of HbA2 1.4%. Her father, presented with Hb 15.1 g/dL, MCV 84.6 fL, MCH 36.7 pg, RBC 4.6 10^12/L, reduced level of HbA2 and normal level of HbF and HbA. The other two cases, were also compound heterozygous with the Hb A2-Deventer, presented with Hb range 12.7-16.4 g/dL, MCV 78.6-87.4 fL, MCH 26-32.4 pg and RBC 4.76-5.06 10^12/L. HPLC and CE analysis shown normal level of HbA2 0-0.2 % and HbF 0.4-0.7 %, HbA 98-100 % respectively, in both cases.

External Links

Phenotype

Hemoglobinopathy Group: Thalassaemia
Hemoglobinopathy Subgroup: α-thalassaemia
Allele Phenotype:N/A
Associated Phenotypes: N/A

Location

Chromosome: 16
Locus: NG_000006.1
Locus Location: 33881
Size: 24 bp
Located at: α2
Specific Location: Intron 1

Other details

Type of Mutation: Point-Mutation(Deletion)
Effect on Gene/Protein Function: N/A
Ethnic Origin: Kadazan-Dusun, Sabah/Rungus
Molecular mechanism: N/A
Inheritance: Recessive
DNA Sequence Determined: Yes

Sequence Viewer

Note: The NCBI Sequence Viewer is not installed on the ITHANET servers but it is embedded in this page from the NCBI. Therefore, IthaGenes has no responsibility over any temporary unavailability of the service. In such a case, please Refresh the page or retry at a later stage. Otherwise, use this external link.

Publications / Origin

To the best of our knowledge, this is unpublished data. Please use with caution!

Microattributions

A/AContributor(s)DateComments
1Mohd Yasin, Norafiza 2020-11-24First report.
Created on 2021-02-09 13:35:42, Last reviewed on (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.