IthaID: 3729
Names and Sequences
Functionality: | Globin gene causative mutation | Pathogenicity: | Variant of Uncertain Significance |
---|---|---|---|
Common Name: | IVS I-11 (-24bp) | HGVS Name: | HBA2:c.95+11_95+34del |
Hb Name: | N/A | Protein Info: | N/A |
Context nucleotide sequence:
GTGAGGCTCC [CTCCCCTGCTCCGACCCGGGCTCC/-] TCGCCCGCCC (Strand: +)
Also known as: Hb Qujing
Comments: Found in six cases. In 1st case, the IVS I-11 (-24bp) reported in compound heterozygosity the with –FIL deletion [IthaID: 311], in a 23-year-old Kadazan-Dusun individual presented with reduced level of Hb 8.8 g/dL, MCV 68.6 fL, MCH 21.3 pg and RBC 4.13 10^12/L, without hepatosplenomegaly and transfusion history. HPLC analysis shown elevated level of HbA2 6 % and HbF 3.7 %, whereas a small peak 15 at zone 11 found with CE. In 2nd case, the IVS I-11 (-24bp) reported in compound heterozygosity with IVS I-5. The individual presented with decreased level of Hb 11.7 g/dL, MCV 63.3 fL, MCH 19.1 pg and RBC 6.11 10^12/L and elevated level of HbA2 4.5 % and HbF 4.8 %. The rest 4 cases are related cases from the same family. The IVS I-11 (-24bp) found in a 29-year old Sabah/Rungus ethnicity female and her 52-year old father in compound heterozygosity with the Hb A2-Deventer [IthaID: 2573]. The daughter presented with normal level of Hb 13.6 g/dL, MCV 81.4 fL, MCH 26.6 pg, RBC 5.12 10^12/L, HbF and HbA and reduced level of HbA2 1.4%. Her father, presented with Hb 15.1 g/dL, MCV 84.6 fL, MCH 36.7 pg, RBC 4.6 10^12/L, reduced level of HbA2 and normal level of HbF and HbA. The other two cases, were also compound heterozygous with the Hb A2-Deventer, presented with Hb range 12.7-16.4 g/dL, MCV 78.6-87.4 fL, MCH 26-32.4 pg and RBC 4.76-5.06 10^12/L. HPLC and CE analysis shown normal level of HbA2 0-0.2 % and HbF 0.4-0.7 %, HbA 98-100 % respectively, in both cases. In a recent publication [PMID: 34708592], the 24bp deletion found in a 40-year-old Chinese male and his father, both presented with normal levels of the hematological and electrophoretic parameters.
Phenotype
Hemoglobinopathy Group: | Thalassaemia |
---|---|
Hemoglobinopathy Subgroup: | α-thalassaemia |
Allele Phenotype: | N/A |
Associated Phenotypes: | N/A |
Location
Chromosome: | 16 |
---|---|
Locus: | NG_000006.1 |
Locus Location: | 33881 |
Size: | 24 bp |
Located at: | α2 |
Specific Location: | Intron 1 |
Other details
Type of Mutation: | Point-Mutation(Deletion) |
---|---|
Effect on Gene/Protein Function: | N/A |
Ethnic Origin: | Kadazan-Dusun, Sabah/Rungus, Chinese |
Molecular mechanism: | N/A |
Inheritance: | Recessive |
DNA Sequence Determined: | Yes |
Sequence Viewer
Publications / Origin
- Zhang J, Xie M, Peng Z, Zhou X, Zhao T, Jin C, Yan Y, Zeng X, Li D, Zhang Y, Su J, Feng N, He J, Yao X, Lv T, Zhu B, Five novel globin gene mutations identified in five Chinese families by next-generation sequencing., Mol Genet Genomic Med, 9(12), e1835, 2021 PubMed
Microattributions
A/A | Contributor(s) | Date | Comments |
---|---|---|---|
1 | Mohd Yasin, Norafiza | 2020-11-24 | First report. |
A/A | Date | Curator(s) | Comments |
---|---|---|---|
1 | 2021-02-09 13:35:42 | The IthaGenes Curation Team | Created |
2 | 2022-01-04 18:35:04 | The IthaGenes Curation Team | Reviewed. Reference, link and origin added. |
3 | 2022-01-05 11:52:26 | The IthaGenes Curation Team | Reviewed. Link added. |