IthaID: 3729
Names and Sequences
Functionality: | Globin gene causative mutation | Pathogenicity: | N/A |
---|---|---|---|
Common Name: | IVS I-11 (-24bp) | HGVS Name: | HBA2:c.95+11_95+34del |
Hb Name: | N/A | Protein Info: | N/A |
Context nucleotide sequence:
GTGAGGCTCC [CTCCCCTGCTCCGACCCGGGCTCC/-] TCGCCCGCCC (Strand: +)
Also known as:
Comments: Found in six cases. In 1st case, the IVS I-11 (-24bp) reported in compound heterozygosity the with –FIL deletion [IthaID: 311], in a 23-year old Kadazan-Dusun individual presented with reduced level of Hb 8.8 g/dL, MCV 68.6 fL, MCH 21.3 pg and RBC 4.13 10^12/L, without hepatosplenomegaly and transfusion history. HPLC analysis shown elevated level of HbA2 6 % and HbF 3.7 %, whereas a small peak 15 at zone 11 found with CE. In 2nd case, the IVS I-11 (-24bp) reported in compound heterozygosity with IVS I-5. The individual presented with decreased level of Hb 11.7 g/dL, MCV 63.3 fL, MCH 19.1 pg and RBC 6.11 10^12/L and elevated level of HbA2 4.5 % and HbF 4.8 %. The rest 4 cases are related cases from the same family. The IVS I-11 (-24bp) found in a 29-year old Sabah/Rungus ethnicity female and her 52-year old father in compound heterozygosity with the Hb A2-Deventer [IthaID: 2573]. The daughter presented with normal level of Hb 13.6 g/dL, MCV 81.4 fL, MCH 26.6 pg, RBC 5.12 10^12/L, HbF and HbA and reduced level of HbA2 1.4%. Her father, presented with Hb 15.1 g/dL, MCV 84.6 fL, MCH 36.7 pg, RBC 4.6 10^12/L, reduced level of HbA2 and normal level of HbF and HbA. The other two cases, were also compound heterozygous with the Hb A2-Deventer, presented with Hb range 12.7-16.4 g/dL, MCV 78.6-87.4 fL, MCH 26-32.4 pg and RBC 4.76-5.06 10^12/L. HPLC and CE analysis shown normal level of HbA2 0-0.2 % and HbF 0.4-0.7 %, HbA 98-100 % respectively, in both cases.
External Links
Phenotype
Hemoglobinopathy Group: | Thalassaemia |
---|---|
Hemoglobinopathy Subgroup: | α-thalassaemia |
Allele Phenotype: | N/A |
Associated Phenotypes: | N/A |
Location
Chromosome: | 16 |
---|---|
Locus: | NG_000006.1 |
Locus Location: | 33881 |
Size: | 24 bp |
Located at: | α2 |
Specific Location: | Intron 1 |
Other details
Type of Mutation: | Point-Mutation(Deletion) |
---|---|
Effect on Gene/Protein Function: | N/A |
Ethnic Origin: | Kadazan-Dusun, Sabah/Rungus |
Molecular mechanism: | N/A |
Inheritance: | Recessive |
DNA Sequence Determined: | Yes |
Sequence Viewer
Publications / Origin
To the best of our knowledge, this is unpublished data. Please use with caution!
Microattributions
A/A | Contributor(s) | Date | Comments |
---|---|---|---|
1 | Mohd Yasin, Norafiza | 2020-11-24 | First report. |
A/A | Date | Curator(s) | Comments |
---|---|---|---|
1 | 2021-02-09 13:35:42 | The IthaGenes Curation Team | Created |