IthaID: 3727



Names and Sequences

Functionality: Globin gene causative mutation Pathogenicity: N/A
Common Name: Cap +23 C>G HGVS Name: HBA2:c.-15C>G
Hb Name: N/A Protein Info: N/A

Context nucleotide sequence:
CCGGCACTCTTCTGGTCCCCACAGACT [C/G] AGAGAACCCACCATGGTGCTGTCTCCT (Strand: +)

Also known as:

Comments: Found in one Malay case presented with Hb 11.5 g/dL, MCV 71.6 fL, MCH 21.7 pg and RBC 5.29 10^12/L. Hb analysis was normal with no abnormal peak.

External Links

Phenotype

Hemoglobinopathy Group: Thalassaemia
Hemoglobinopathy Subgroup: α-thalassaemia
Allele Phenotype:α⁺
Associated Phenotypes: N/A

Location

Chromosome: 16
Locus: NG_000006.1
Locus Location: 33761
Size: 1 bp
Located at: α2
Specific Location: 5'UTR

Other details

Type of Mutation: Point-Mutation(Substitution)
Effect on Gene/Protein Function: 5'UTR (Transcription)
Ethnic Origin: Malay
Molecular mechanism: N/A
Inheritance: Recessive
DNA Sequence Determined: Yes

Sequence Viewer

Note: The NCBI Sequence Viewer is not installed on the ITHANET servers but it is embedded in this page from the NCBI. Therefore, IthaGenes has no responsibility over any temporary unavailability of the service. In such a case, please Refresh the page or retry at a later stage. Otherwise, use this external link.

Publications / Origin

To the best of our knowledge, this is unpublished data. Please use with caution!

Microattributions

A/AContributor(s)DateComments
1Mohd Yasin, Norafiza 2020-11-24First report.
Created on 2021-02-09 08:48:01, Last reviewed on (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.