IthaID: 3725
Names and Sequences
| Functionality: | Globin gene causative mutation | Pathogenicity: | Benign / Likely Benign |
|---|---|---|---|
| Common Name: | -4 G>C | HGVS Name: | HBA2:c.-41C>G |
| Hb Name: | N/A | Protein Info: | N/A |
Context nucleotide sequence:
GCATAAACCCTGGCGCGCTCGCGGGC [C/G] GGCACTCTTCTGGTCCCCACAGACTCA (Strand: +)
Also known as:
Comments: Found in three unrelated cases (Malay and Indian) presented clinically normal with mild low MCV and MCH and normal HbA2 level. GAP-PCR showed presence of two abnormal bands around 3.7 gene deletion in 2 cases. Recently, the substitution reported in a 17-year old male with Hb 14.4 g/dL, MCV 77.2 fL, MCH 24.2 pg, RBC 5.96 10^12/L and RDW 13.2 % with normal HbA2 value. GAP-PCR showed presence of two abnormal bands around 3.7 gene deletion. Molecular analysis showed the substitution C>G at both HbA1 and HbA2 regions.
We follow the HGVS sequence variant nomenclature and IUPAC standards.
External Links
Phenotype
| Hemoglobinopathy Group: | Thalassaemia |
|---|---|
| Hemoglobinopathy Subgroup: | α-thalassaemia |
| Allele Phenotype: | N/A |
| Associated Phenotypes: | N/A |
Location
| Chromosome: | 16 |
|---|---|
| Locus: | NG_000006.1 |
| Locus Location: | 33735 |
| Size: | 1 bp |
| Located at: | α2 |
| Specific Location: | Promoter |
Other details
| Type of Mutation: | Point-Mutation(Substitution) |
|---|---|
| Effect on Gene/Protein Function: | Promoter (Transcription) |
| Ethnic Origin: | Malay, Indian |
| Molecular mechanism: | N/A |
| Inheritance: | Recessive |
| DNA Sequence Determined: | Yes |
In silico pathogenicity prediction
Sequence Viewer
Publications / Origin
To the best of our knowledge, this is unpublished data. Please use with caution!
Microattributions
| A/A | Contributor(s) | Date | Comments |
|---|---|---|---|
| 1 | Mohd Yasin, Norafiza | 2020-11-24 | First report. |
| A/A | Date | Curator(s) | Comments |
|---|---|---|---|
| 1 | 2021-02-09 08:37:40 | The IthaGenes Curation Team | Created |
| 2 | 2021-02-12 08:20:04 | The IthaGenes Curation Team | Reviewed. Link added. |
| 3 | 2021-04-01 00:06:32 | The IthaGenes Curation Team | Reviewed. HGVS name corrected. |
| 4 | 2021-04-01 00:12:05 | The IthaGenes Curation Team | Reviewed. Link deleted. |
| 5 | 2021-12-17 09:56:31 | The IthaGenes Curation Team | Reviewed. HGVS name corrected. |
| 6 | 2021-12-17 09:58:24 | The IthaGenes Curation Team | Reviewed. Chromosome location corrected. |