IthaID: 3720
Names and Sequences
| Functionality: | Globin gene causative mutation | Pathogenicity: | N/A |
|---|---|---|---|
| Common Name: | CD 1/2 (+TG) | HGVS Name: | HBA2:c.6_7insTG |
| Hb Name: | N/A | Protein Info: | N/A |
Context nucleotide sequence:
GACTCAGAGAGAACCCACCATGGTGC [-/TG] TGTCTCCTGCCGACAAGACCAACGTC (Strand: +)
Also known as:
Comments: Found in two unrelated individuals. One of them was a 12-month old male infant with reduced Hb 9.0 g/dL, MCV 59.2 fL MCH 17.8 pg. The second individual was a 36-year old woman presented with marginally normal hematological indices (Hb 11.7 g/dL, MCV 80.6 fL, MCH 26 pg). Direct DNA sequencing showed that this mutation was inherited from her mother and her two daughters were both heterozygous for this mutation presented with slightly reduced MCV and MCH. The 2-bp insertion resulting in a completely different polypeptide from the original a2-globin peptide.
We follow the HGVS sequence variant nomenclature and IUPAC standards.
External Links
No available links
Phenotype
| Hemoglobinopathy Group: | Thalassaemia |
|---|---|
| Hemoglobinopathy Subgroup: | α-thalassaemia |
| Allele Phenotype: | N/A |
| Associated Phenotypes: | N/A |
Location
| Chromosome: | 16 |
|---|---|
| Locus: | NG_000006.1 |
| Locus Location: | 33781 |
| Size: | 2 bp |
| Located at: | α2 |
| Specific Location: | Exon 1 |
Other details
| Type of Mutation: | Point-Mutation(Insertion) |
|---|---|
| Effect on Gene/Protein Function: | Frameshift (Translation) |
| Ethnic Origin: | Chinese |
| Molecular mechanism: | N/A |
| Inheritance: | Recessive |
| DNA Sequence Determined: | Yes |
In silico pathogenicity prediction
Sequence Viewer
Publications / Origin
To the best of our knowledge, this is unpublished data. Please use with caution!
| A/A | Date | Curator(s) | Comments |
|---|---|---|---|
| 1 | 2021-01-30 14:49:20 | The IthaGenes Curation Team | Created |
| 2 | 2021-01-30 14:52:39 | The IthaGenes Curation Team | Reviewed. Chromosome location corrected. |