IthaID: 3709
Names and Sequences
| Functionality: | Disease modifying mutation | Pathogenicity: | N/A | 
|---|---|---|---|
| Common Name: | rs75853687 | HGVS Name: | NC_000005.10:g.159850278G>A | 
We follow the 
						 
							HGVS sequence variant nomenclature
						
						and
						 
							 IUPAC standards.
						
					
					
					
Context nucleotide sequence:
GGGTTTCAGGGCTTGGGCAAGC [G>A] TGAGTGATTCGCACTCTGGCAGG  (Strand: +)
Comments: Allele 'A' associated with an increased susceptibility to develop alloantibodies in transfused sickle cell disease (SCD) patients of African ancestry. Nominally replicated in an independent cohort of SCD transfusion recipients. Located in an enhancer region embedded within the lncRNA gene LINC01847 and is near binding sites for multiple transcription factors and enhancer binding proteins, such as CEBPB (pro-inflammatory function).
External Links
Phenotype
| Allele Phenotype (Cis): | N/A | 
|---|---|
| Allele Phenotype (Trans): | N/A | 
| Associated Phenotypes: | Red blood cell alloimmunisation | 
Location
| Chromosome: | 5 | 
|---|---|
| Locus: | NR_109891.1 | 
| Locus Location: | N/A | 
| Size: | 1 bp | 
| Located at: | LINC01847 | 
| Specific Location: | Intron 2 | 
Other details
| Type of Mutation: | Point-Mutation(Substitution) | 
|---|---|
| Effect on Gene/Protein Function: | N/A | 
| Ethnic Origin: | African American | 
| Molecular mechanism: | N/A | 
| Inheritance: | Quantitative trait | 
| DNA Sequence Determined: | Yes | 
In silico pathogenicity prediction
Sequence Viewer
								 Note:  The NCBI Sequence Viewer is not installed on the ITHANET servers but it is embedded in this page from the NCBI.
								Therefore, IthaGenes has no responsibility over any temporary unavailability of the service.
								In such a case, please Refresh the page or retry at a later stage.
								Otherwise, use this external link.
							
							
						Publications / Origin
- Williams LM, Qi Z, Batai K, Hooker S, Hall NJ, Machado RF, Chen A, Campbell-Lee S, Guan Y, Kittles R, Hanchard NA, A locus on chromosome 5 shows African ancestry-limited association with alloimmunization in sickle cell disease., Blood Adv, 2(24), 3637-3647, 2018 PubMed
 
					Created on 2020-12-09 14:00:07,
					Last reviewed on 2020-12-09 14:00:41					(Show full history)
				
				
			
 Disclaimer: The information on this website is provided as an information resource only
    and must not to be used as a substitute for professional diagnosis and treatment.
    The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment,
    diagnosis or any other information, services or products that an individual obtains through this website.