IthaID: 3707
Names and Sequences
Functionality: | Disease modifying mutation | Pathogenicity: | N/A |
---|---|---|---|
Common Name: | rs56737264 | HGVS Name: | NC_000002.12:g.15094029A>G |
Context nucleotide sequence:
GAGACTCAGAAAGTGAGTTGTATTC [A>G] TTGTTAATAATAGTTTCAGAAAGA (Strand: +)
Also known as:
Comments: Genic Downstream Transcript Variant (NM_015909.4:c.). Associated with red blood cell alloimmunization in transfused patients with sickle cell disease. In strong LD with imputed SNP rs66516066.
External Links
Phenotype
Allele Phenotype (Cis): | N/A |
---|---|
Allele Phenotype (Trans): | N/A |
Associated Phenotypes: | Red blood cell alloimmunisation |
Location
Chromosome: | 2 |
---|---|
Locus: | NG_032964.1 |
Locus Location: | N/A |
Size: | 1 bp |
Located at: | NBAS |
Specific Location: | N/A |
Other details
Type of Mutation: | Point-Mutation(Substitution) |
---|---|
Effect on Gene/Protein Function: | N/A |
Ethnic Origin: | African American |
Molecular mechanism: | N/A |
Inheritance: | Quantitative trait |
DNA Sequence Determined: | Yes |
Sequence Viewer
Note: The NCBI Sequence Viewer is not installed on the ITHANET servers but it is embedded in this page from the NCBI.
Therefore, IthaGenes has no responsibility over any temporary unavailability of the service.
In such a case, please Refresh the page or retry at a later stage.
Otherwise, use this external link.
Publications / Origin
- Williams LM, Qi Z, Batai K, Hooker S, Hall NJ, Machado RF, Chen A, Campbell-Lee S, Guan Y, Kittles R, Hanchard NA, A locus on chromosome 5 shows African ancestry-limited association with alloimmunization in sickle cell disease., Blood Adv, 2(24), 3637-3647, 2018 PubMed
Created on 2020-12-09 13:20:15,
Last reviewed on (Show full history)
A/A | Date | Curator(s) | Comments |
---|---|---|---|
1 | 2020-12-09 13:20:15 | The IthaGenes Curation Team | Created |
Disclaimer: The information on this website is provided as an information resource only
and must not to be used as a substitute for professional diagnosis and treatment.
The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment,
diagnosis or any other information, services or products that an individual obtains through this website.
IthaGenes was last updated on 2021-03-05 12:55:33