IthaID: 3703



Names and Sequences

Functionality: Disease modifying mutation Pathogenicity: N/A
Common Name: rs2617160 HGVS Name: NC_000012.12:g.10392998A>T

Context nucleotide sequence:
TATTTTCCATTCAGCTAGGTATTA [A>T] GTACTGGGCTACACATACTGACA (Strand: -)

Also known as:

Comments: The 'A' allele associated with a lower frequency of retinopathy in a cohort of sickle cell disease patients (mainly from sub-Saharan Africa).

We follow the HGVS sequence variant nomenclature and IUPAC standards.

External Links

Phenotype

Allele Phenotype (Cis):N/A
Allele Phenotype (Trans):N/A
Associated Phenotypes: Retinopathy [HP:0000488]

Location

Chromosome: 12
Locus: NM_001199805.1
Locus Location: N/A
Size: 1 bp
Located at: KLRC4-KLRK1
Specific Location: Intron 5

Other details

Type of Mutation: Point-Mutation(Substitution)
Effect on Gene/Protein Function: N/A
Ethnic Origin: African
Molecular mechanism: N/A
Inheritance: Quantitative trait
DNA Sequence Determined: No

In silico pathogenicity prediction

Sequence Viewer

Note: The NCBI Sequence Viewer is not installed on the ITHANET servers but it is embedded in this page from the NCBI. Therefore, IthaGenes has no responsibility over any temporary unavailability of the service. In such a case, please Refresh the page or retry at a later stage. Otherwise, use this external link.

Publications / Origin

  1. Tozatto-Maio K, Girot R, Ly ID, Silva Pinto AC, Rocha V, Fernandes F, Diagne I, Benzerara Y, Dinardo CL, Soler JP, Kashima S, Araujo IL, Kenzey C, Fonseca GHH, Rodrigues ES, Volt F, Jarduli L, Ruggeri A, Mariaselvam C, Gualandro SFM, Rafii H, Cappelli B, Nogueira FM, Scigliuolo GM, Guerino-Cunha RL, Malmegrim KCR, Simões BP, Gluckman E, Tamouza R, Polymorphisms in Inflammatory Genes Modulate Clinical Complications in Patients With Sickle Cell Disease., Front Immunol, 11(0), 2041, 2020 PubMed
Created on 2020-11-17 16:16:35, Last reviewed on (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.