IthaID: 37



Names and Sequences

Functionality: Neutral polymorphism Pathogenicity: Benign / Likely Benign
Common Name: CAP +20 C>T; IVS II-745 C>G HGVS Name: HBB:c.[-31C>T;316-106C>G]

We follow the HGVS sequence variant nomenclature and IUPAC standards.

Context nucleotide sequence:
TTGCTTACATTTGCTTCTGACACAA [C/T] TGTGTTCACTAGCAACCTCAAACAG (Strand: -)

Comments: The c.-31C>T variant in the 5'UTR of the HBB gene is considered an innocuous SNP associated in cis with IVS II-745 [IthaID: 214]. In two transfusion-dependent beta-thalassemia patients from Brazil, this in cis variant was co-inherited separately with IVS I-6 T>C [IthaID: 111] in one patient and with β0 CD39 [IthaID: 142] in the other. Homozygosity for the in cis variant was associated with thalassemia major or intermedia in a Turkish proband, as well as in two related Iranian individuals with a history of transfusion dependency from early infancy. It was also identified in three unrelated Spanish families, where heterozygous carriers exhibited a thalassemia trait phenotype, while compound heterozygotes with a β+ or β0 allele presented with thalassemia major.

Phenotype

Allele Phenotype:Neutral
Associated Phenotypes: N/A

Location

Chromosome: 11
Locus: NG_000007.3
Locus Location: 70564 or 71784
Size: 1 bp or 1 bp
Located at: β
Specific Location: 5'UTR

Other details

Type of Mutation: Point-Mutation(Substitution)
Effect on Gene/Protein Function: 5'UTR (Transcription)
Ethnic Origin: Turkish, Iranian, Spanish
Molecular mechanism: N/A
Inheritance: Quantitative trait
DNA Sequence Determined: Yes

In silico pathogenicity prediction

Sequence Viewer

Note: The NCBI Sequence Viewer is not installed on the ITHANET servers but it is embedded in this page from the NCBI. Therefore, IthaGenes has no responsibility over any temporary unavailability of the service. In such a case, please Refresh the page or retry at a later stage. Otherwise, use this external link.

Frequencies

Publications / Origin

  1. Gonzalez-Redondo JM, Stoming TA, Kutlar A, Kutlar F, Lanclos KD, Howard EF, Fei YJ, Aksoy M, Altay C, Gurgey A, A C----T substitution at nt--101 in a conserved DNA sequence of the promotor region of the beta-globin gene is associated with , Blood , 73(6), 1705-11, 1989 PubMed
  2. Yavarian M, Harteveld CL, Batelaan D, Bernini LF, Giordano PC, Molecular spectrum of beta-thalassemia in the Iranian Province of Hormozgan., Hemoglobin, 25(1), 35-43, 2001 PubMed
  3. Galehdari H, Salehi B, Pedram M, Oraki Kohshour M, High prevalence of rare mutations in the Beta globin gene in an ethnic group in iran., Iran Red Crescent Med J, 13(5), 356-8, 2011 PubMed
  4. Ropero P, González FA, Cela E, Beléndez C, Cervera A, Martínez-Nieto J, de la Fuente-Gonzalo F, Vinuesa L, Villegas A, Díaz-Mediavilla J, Association in cis of the mutations +20 (C>T) in the 5' untranslated region and IVS-II-745 (C>G) on the β-globin gene., Hemoglobin , 37(2), 112-8, 2013 PubMed
Created on 2010-06-16 16:13:14, Last reviewed on 2025-03-14 08:28:53 (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.