IthaID: 37



Names and Sequences

Functionality: Neutral polymorphism Pathogenicity: Benign / Likely Benign
Common Name: CAP +20 C>T; IVS II-745 C>G HGVS Name: HBB:c.[-31C>T;316-106C>G]

Context nucleotide sequence:
TTGCTTACATTTGCTTCTGACACAA [C/T] TGTGTTCACTAGCAACCTCAAACAG (Strand: -)

Also known as:

Comments: This mutation is an innocuous SNP associated with the IVSII-745 mutation in cis.

Phenotype

Allele Phenotype:Neutral
Associated Phenotypes: N/A

Location

Chromosome: 11
Locus: NG_000007.3
Locus Location: 70564 or 71784
Size: 1 bp or 1 bp
Located at: β
Specific Location: 5'UTR

Other details

Type of Mutation: Point-Mutation(Substitution)
Effect on Gene/Protein Function: 5'UTR (Transcription)
Ethnic Origin: Bulgarian, Iranian, Mediterranean
Molecular mechanism: N/A
Inheritance: Quantitative trait
DNA Sequence Determined: Yes

Sequence Viewer

Note: The NCBI Sequence Viewer is not installed on the ITHANET servers but it is embedded in this page from the NCBI. Therefore, IthaGenes has no responsibility over any temporary unavailability of the service. In such a case, please Refresh the page or retry at a later stage. Otherwise, use this external link.

Frequencies

Publications / Origin

  1. Galehdari H, Salehi B, Pedram M, Oraki Kohshour M, High prevalence of rare mutations in the Beta globin gene in an ethnic group in iran., Iran Red Crescent Med J, 13(5), 356-8, 2011 PubMed
  2. Ropero P, González FA, Cela E, Beléndez C, Cervera A, Martínez-Nieto J, de la Fuente-Gonzalo F, Vinuesa L, Villegas A, Díaz-Mediavilla J, Association in cis of the mutations +20 (C>T) in the 5' untranslated region and IVS-II-745 (C>G) on the β-globin gene., Hemoglobin , 37(2), 112-8, 2013 PubMed
Created on 2010-06-16 16:13:14, Last reviewed on 2021-09-29 12:13:41 (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.