IthaID: 3698



Names and Sequences

Functionality: Disease modifying mutation Pathogenicity: N/A
Common Name: rs16998911 HGVS Name: NG_016419.1:g.49280T>C

Context nucleotide sequence:
CCCAAGGACCATGTAGAATTTGTAA [T>C] GGACTTATCACCTACACAAATCAGT (Strand: +)

Also known as:

Comments: Significant association with high F cell numbers (in the range of 13 to 30%) and HbF levels (>4%) in males with sickle cell disease from Tanzania. The association was not replicated in female patients. rs16998911 is an X-linked determinant of Fcells% also explaining gender differences in F-cell distribution in SCD patients.

External Links

Phenotype

Allele Phenotype (Cis):N/A
Allele Phenotype (Trans):N/A
Associated Phenotypes: Hb F levels [HP:0011904] [OMIM:141749]
F-cell numbers

Location

Chromosome: X
Locus: NG_016419.1
Locus Location: 49280
Size: 1 bp
Located at: FRMPD4
Specific Location: Intron 1

Other details

Type of Mutation: Point-Mutation(Substitution)
Effect on Gene/Protein Function: N/A
Ethnic Origin: Tanzanian
Molecular mechanism: N/A
Inheritance: Quantitative trait
DNA Sequence Determined: Yes

Sequence Viewer

Note: The NCBI Sequence Viewer is not installed on the ITHANET servers but it is embedded in this page from the NCBI. Therefore, IthaGenes has no responsibility over any temporary unavailability of the service. In such a case, please Refresh the page or retry at a later stage. Otherwise, use this external link.

Publications / Origin

  1. Urio F, Nkya S, Rooks H, Mgaya JA, Masamu U, Zozimus Sangeda R, Mmbando BP, Brumat M, Mselle T, Menzel S, Luzzatto L, Makani J, F cell numbers are associated with an X-linked genetic polymorphism and correlate with haematological parameters in patients with sickle cell disease., Br J Haematol, 2020 PubMed
Created on 2020-11-12 13:26:57, Last reviewed on 2020-11-12 13:27:32 (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.